Stem-loop sequence cel-mir-239a

AccessionMI0000314 (change log)
DescriptionCaenorhabditis elegans miR-239a stem-loop
Gene family MIPF0000135; mir-239
Literature search

5 open access papers mention cel-mir-239a
(48 sentences)

Stem-loop
   ------u    guuu     u         c  a   gu      caauuuu 
5'        acac    gcaau uuuguacua ac uag  acugga       c
          ||||    ||||| ||||||||| || |||  ||||||        
3'        ugug    cguua aaacgugau ug auc  ugaccu       a
   aguuugu    -gcu     c         c  -   ug      auauaaa 
Get sequence
Deep sequencing
40575 reads, 675 reads per million, 16 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 11792445-11792542 [+]
intergenic
Clustered miRNAs
< 10kb from cel-mir-239a
cel-mir-239bchrX: 11791302-11791399 [-]
cel-mir-239achrX: 11792445-11792542 [+]
Database links

Mature sequence cel-miR-239a-5p

Accession MIMAT0000294
Previous IDscel-miR-239a
Sequence

16 - 

uuuguacuacacauagguacugg

 - 38

Get sequence
Deep sequencing38506 reads, 16 experiments
Evidence experimental; cloned [1,3], Northern [1], Illumina [4,6], CLIPseq [5]
Database links
Predicted targets

Mature sequence cel-miR-239a-3p

Accession MIMAT0020334
Previous IDscel-miR-239a*
Sequence

59 - 

agugucuagucuagugcaaaca

 - 80

Get sequence
Deep sequencing2054 reads, 15 experiments
Evidence experimental; Illumina [6]
Database links

References

1
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
2
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
3
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
4
5
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
6