Stem-loop sequence cel-mir-238

AccessionMI0000313 (change log)
DescriptionCaenorhabditis elegans miR-238 stem-loop
Gene family MIPF0000862; mir-238
Literature search

3 open access papers mention cel-mir-238
(7 sentences)

Stem-loop
   ----u   cau              uuc     c  u        cau    c 
5'      cuc   ugacuguuuggaug   ucgga gu caaagcua   ccaa a
        |||   ||||||||||||||   ||||| || ||||||||   ||||  
3'      gag   auugauagacuuac   agccu ca guuucgau   gguu a
   guacc   --u              cgu     -  u        ---    a 
Get sequence
Deep sequencing
241490 reads, 1.77e+03 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIII: 8867328-8867425 [-]
intergenic
Clustered miRNAs
< 10kb from cel-mir-238
cel-mir-90chrIII: 8873987-8874084 [-]
cel-mir-238chrIII: 8867328-8867425 [-]
cel-mir-80chrIII: 8865270-8865367 [-]
Database links

Mature sequence cel-miR-238-5p

Accession MIMAT0015114
Previous IDscel-miR-238*
Sequence

16 - 

uggauguucucggacguucaaagc

 - 39

Get sequence
Deep sequencing7199 reads, 16 experiments
Evidence experimental; CLIPseq [5]
Database links
Predicted targets

Mature sequence cel-miR-238-3p

Accession MIMAT0000293
Previous IDscel-miR-238
Sequence

61 - 

uuuguacuccgaugccauucaga

 - 83

Get sequence
Deep sequencing234263 reads, 17 experiments
Evidence experimental; cloned [1-3], Northern [1], Illumina [4], CLIPseq [5]
Database links
Predicted targets

References

1
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
2
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
3
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
4
5
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).