Stem-loop sequence cel-mir-237

AccessionMI0000312 (change log)
DescriptionCaenorhabditis elegans miR-237 stem-loop
Gene family MIPF0000904; mir-237
Literature search

5 open access papers mention cel-mir-237
(11 sentences)

Stem-loop
   --------------     ca   cg      c   g  uu     a      c  a 
5'               uucua  uug  uggucc uga aa  cucga cagcuu aa g
                 |||||  |||  |||||| ||| ||  ||||| |||||| ||  
3'               aagau  aac  accagg acu uu  gagcu gucgaa uu u
   caaggguucacuag     --   aa      a   g  uu     -      c  g 
Get sequence
Deep sequencing
15155 reads, 217 reads per million, 12 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The sequence is reported to be related to lin-4 [2]. The extents of the dominant mature miRNA species are adjusted here in accordance with a large scale cloning and sequencing study [3].

Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 8154084-8154182 [+]
intergenic
Database links

Mature sequence cel-miR-237-5p

Accession MIMAT0000292
Previous IDscel-miR-237
Sequence

16 - 

ucccugagaauucucgaacagcu

 - 38

Get sequence
Deep sequencing14753 reads, 12 experiments
Evidence experimental; cloned [1-3], Northern [1], Illumina [4,6], CLIPseq [5]
Database links
Predicted targets

Mature sequence cel-miR-237-3p

Accession MIMAT0020333
Previous IDscel-miR-237*
Sequence

53 - 

cugucgaguuuugucaaggacc

 - 74

Get sequence
Deep sequencing399 reads, 11 experiments
Evidence experimental; Illumina [6]
Database links

References

1
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
2
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
3
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
4
5
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
6