Stem-loop sequence cel-mir-236

AccessionMI0000311 (change log)
DescriptionCaenorhabditis elegans miR-236 stem-loop
Gene family MIPF0000232; mir-236
Stem-loop
   ucg     -c    -         -       uu  a    u   -  gacu 
5'    gugac  gaug uccagcguc uuaccug  ca uauu aga cu    a
      |||||  |||| ||||||||| |||||||  || |||| ||| ||    u
3'    uacug  cugu aggucgcag aauggac  gu auaa ucu ga    c
   ---     ua    u         u       -u  c    -   a  gaaa 
Get sequence
Deep sequencing
79959 reads, 594 reads per million, 16 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This precursor sequence was predicted by comparative computational approaches [1,3]. The excised miRNA sequence was predicted to comprise bases 64 to 87, and the precise 5' and 3' ends were determined later [4]. Northern blotting confirmed that the strand containing the predicted miR is predominantly expressed.

Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrII: 7030180-7030277 [-]
intergenic
Database links

Mature sequence cel-miR-236-5p

Accession MIMAT0020332
Previous IDscel-miR-236*
Sequence

19 - 

cgucuuaccuguucaauauuuaga

 - 42

Get sequence
Deep sequencing139 reads, 15 experiments
Evidence experimental; Illumina [7]
Database links

Mature sequence cel-miR-236-3p

Accession MIMAT0000291
Previous IDscel-miR-236
Sequence

61 - 

uaauacugucagguaaugacgcu

 - 83

Get sequence
Deep sequencing79723 reads, 16 experiments
Evidence experimental; cloned [1-2,4], Northern [1,3], PCR [3], Illumina [5,7], CLIPseq [6]
Database links
Predicted targets

References

1
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
2
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
3
PMID:12769849 "Computational and experimental identification of C. elegans microRNAs" Grad Y, Aach J, Hayes GD, Reinhart BJ, Church GM, Ruvkun G, Kim J Mol Cell. 11:1253-1263(2003).
4
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
5
6
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
7