Stem-loop sequence cel-mir-236

Accession

MI0000311 (change log)

Description

Caenorhabditis elegans miR-236 stem-loop

Gene family

MIPF0000232; mir-236

Stem-loop

   ucg     -c    -         -       uu  a    u   -  gacu 
5'    gugac  gaug uccagcguc uuaccug  ca uauu aga cu    a
      |||||  |||| ||||||||| |||||||  || |||| ||| ||    u
3'    uacug  cugu aggucgcag aauggac  gu auaa ucu ga    c
   ---     ua    u         u       -u  c    -   a  gaaa 

Deep sequencing

79959 reads, 594 reads per million, 16 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

This precursor sequence was predicted by comparative computational approaches [1,3]. The excised miRNA sequence was predicted to comprise bases 64 to 87, and the precise 5' and 3' ends were determined later [4]. Northern blotting confirmed that the strand containing the predicted miR is predominantly expressed.

Genome context

• Coordinates (WBcel235; GCA_000002985.3): chrII: 7030180-7030277 [-]
• Overlapping transcripts:

  intergenic

Database links

• RNAcentral:URS000037982D_6239
• miRBase Tracker:MI0000311

Mature sequence cel-miR-236-5p

• Accession: MIMAT0020332
• Previous IDs: cel-miR-236*
• Sequence: 19 - cgucuuaccuguucaauauuuaga - 42
• Deep sequencing: 139 reads, 15 experiments
• Evidence: experimental; Illumina [7]
• Database links:
  • RNAcentral:URS000004BFC1_6239

Mature sequence cel-miR-236-3p

• Accession: MIMAT0000291
• Previous IDs: cel-miR-236
• Sequence: 61 - uaauacugucagguaaugacgcu - 83
• Deep sequencing: 79723 reads, 16 experiments
• Evidence: experimental; cloned [1-2,4], Northern [1,3], PCR [3], Illumina [5,7], CLIPseq [6]
• Database links:
  • RNAcentral:URS00003BC5F2_6239
• Predicted targets:
  • TargetScanWorm:cel-miR-236
  • microrna.org:cel-miR-236-3p

References

1. PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
2. PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
3. PMID:12769849 "Computational and experimental identification of C. elegans microRNAs" Grad Y, Aach J, Hayes GD, Reinhart BJ, Church GM, Ruvkun G, Kim J Mol Cell. 11:1253-1263(2003).
4. PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
5. PMID:19460142 "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development" Kato M, de Lencastre A, Pincus Z, Slack FJ Genome Biol. 10:R54(2009).
6. PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
7. PMID:21307183 "Improved annotation of C. elegans microRNAs by deep sequencing reveals structures associated with processing by Drosha and Dicer" Warf MB, Johnson WE, Bass BL RNA. 17:563-577(2011).