Stem-loop sequence cel-mir-233

AccessionMI0000308 (change log)
DescriptionCaenorhabditis elegans miR-233 stem-loop
Gene family MIPF0000312; mir-233
Literature search

5 open access papers mention cel-mir-233
(107 sentences)

Stem-loop
   aua    -   uu          c   c -        c    u  uaac 
5'    uagc auc  ucugucucgc cau c cguugcuc aaua uc    a
      |||| |||  |||||||||| ||| | |||||||| |||| ||    a
3'    gucg uag  agauagggcg gua g guaacgag uuau ag    c
   --c    g   uc          u   c c        -    u  ugaa 
Get sequence
Deep sequencing
18814 reads, 176 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 12078587-12078684 [-]
sense
W03G11.4.1 ; W03G11.4.1; intron 2
W03G11.4.3 ; W03G11.4.3; intron 2
W03G11.4.2 ; W03G11.4.2; intron 3
Database links

Mature sequence cel-miR-233-5p

Accession MIMAT0020329
Previous IDscel-miR-233*
Sequence

19 - 

ucgcccaucccguugcuccaaua

 - 41

Get sequence
Deep sequencing24 reads, 9 experiments
Evidence experimental; Illumina [6]
Database links

Mature sequence cel-miR-233-3p

Accession MIMAT0000288
Previous IDscel-miR-233
Sequence

61 - 

uugagcaaugcgcaugugcggga

 - 83

Get sequence
Deep sequencing18776 reads, 17 experiments
Evidence experimental; cloned [1], Northern [1], 454 [3], Illumina [4,6], CLIPseq [5]
Database links
Predicted targets

References

1
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
2
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
3
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
4
5
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
6