Stem-loop sequence cel-mir-232

AccessionMI0000307 (change log)
DescriptionCaenorhabditis elegans miR-232 stem-loop
Gene family MIPF0000311; mir-232
Literature search

1 open access papers mention cel-mir-232
(6 sentences)

Stem-loop
   aa     auu        c        uc    au      - uuaau  u 
5'   guuca   uuuggauc cugcaguu  gaug  uuuauc c     uc g
     |||||   |||||||| ||||||||  ||||  |||||| |     ||  
3'   caagu   agaucuag ggcgucaa  cuac  aaauag g     ag a
   -a     acu        u        uu    gu      u ----u  a 
Get sequence
Deep sequencing
6812 reads, 88.2 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIV: 10994169-10994266 [-]
intergenic
Database links

Mature sequence cel-miR-232-5p

Accession MIMAT0020777
Sequence

19 - 

ccugcaguuucgaugauuuuauc

 - 41

Get sequence
Deep sequencing3083 reads, 15 experiments
Evidence experimental; Illumina [6]
Database links

Mature sequence cel-miR-232-3p

Accession MIMAT0000287
Previous IDscel-miR-232
Sequence

61 - 

uaaaugcaucuuaacugcgguga

 - 83

Get sequence
Deep sequencing3694 reads, 15 experiments
Evidence experimental; cloned [1-2], Northern [1], 454 [3], Illumina [4,6], CLIPseq [5]
Database links
Predicted targets

References

1
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
2
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
3
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
4
5
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
6