Stem-loop sequence cel-mir-231

AccessionMI0000306 (change log)
DescriptionCaenorhabditis elegans miR-231 stem-loop
Gene family MIPF0000307; mir-231
Literature search

3 open access papers mention cel-mir-231
(74 sentences)

Stem-loop 
   ua   cc  -a          a     --   aa        ---g   cuu 
5'   gca  ac  gguuguucug cuguu  uca  agcuugua    uau   a
     |||  ||  |||||||||| |||||  |||  ||||||||    |||    
3'   ugu  ug  ucaacaagac gacaa  agu  ucgaauau    aua   a
   -g   uu  gc          g     cu   gc        acaa   aau
Get sequence
Deep sequencing
14419 reads, 218 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIII: 7545057-7545155 [-]
sense
R13A5.17 ; R13A5.17; exon 1
Database links

Mature sequence cel-miR-231-5p

Accession MIMAT0020328
Previous IDscel-miR-231*
Sequence

18 -  

cugacuguuucaaaagcuugua

 - 39

Get sequence
Deep sequencing241 reads, 15 experiments
Evidence experimental; Illumina [6]
Database links

Mature sequence cel-miR-231-3p

Accession MIMAT0000286
Previous IDscel-miR-231
Sequence

61 -  

uaagcucgugaucaacaggcagaa

 - 84

Get sequence
Deep sequencing14172 reads, 17 experiments
Evidence experimental; cloned [1-2], Northern [1], 454 [3], Illumina [4,6], CLIPseq [5]
Database links
Predicted targets

References

1
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
2
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
3
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
4
PMID:19460142 "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development" Kato M, de Lencastre A, Pincus Z, Slack FJ Genome Biol. 10:R54(2009).
5
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
6
PMID:21307183 "Improved annotation of C. elegans microRNAs by deep sequencing reveals structures associated with processing by Drosha and Dicer" Warf MB, Johnson WE, Bass BL RNA. 17:563-577(2011).