Stem-loop sequence cel-mir-230

AccessionMI0000305 (change log)
DescriptionCaenorhabditis elegans miR-230 stem-loop
Gene family MIPF0000306; mir-230
Literature search

2 open access papers mention cel-mir-230
(3 sentences)

Stem-loop
   uug    -         a        -      u       u   aaca 
5'    augu aaugccguc cuuggucg gcgauu aauauua cag    u
      |||| ||||||||| |||||||| |||||| ||||||| |||    a
3'    uacg uuauggcag ggaccagc uguuga uuaugau guu    g
   uua    c         a        g      -       u   aaag 
Get sequence
Deep sequencing
139851 reads, 473 reads per million, 15 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 5803892-5803989 [+]
intergenic
Clustered miRNAs
< 10kb from cel-mir-230
cel-mir-230chrX: 5803892-5803989 [+]
cel-mir-791chrX: 5809349-5809433 [+]
Database links

Mature sequence cel-miR-230-5p

Accession MIMAT0015113
Previous IDscel-miR-230*
Sequence

17 - 

acuuggucggcgauuuaauauua

 - 39

Get sequence
Deep sequencing20814 reads, 15 experiments
Evidence experimental; CLIPseq [5]
Database links
Predicted targets

Mature sequence cel-miR-230-3p

Accession MIMAT0000285
Previous IDscel-miR-230
Sequence

61 - 

guauuaguugugcgaccaggaga

 - 83

Get sequence
Deep sequencing119032 reads, 15 experiments
Evidence experimental; cloned [1], Northern [1], 454 [3], Illumina [4], CLIPseq [5]
Database links
Predicted targets

References

1
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
2
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
3
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
4
5
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).