Stem-loop sequence cel-mir-229

Accession MI0000304
Description Caenorhabditis elegans miR-229 stem-loop
Stem-loop 
       a        g u        cca    ggaaugccccccauugauuuuuuc 
cgccggc augacacu g uaucuuuu   ucgu                        c
||||||| |||||||| | ||||||||   ||||                         
gcggccg uacugugg c auggaaag   agca                        c
       a        g u        ---    aagguuaaaaaaggggggcuuuuc
Get sequence
Deep sequencing
5703 reads, 6 experiments
Comments

The extents of the dominant mature miRNA species are adjusted here in accordance with a large scale cloning and sequencing study [3].

Genome context
Coordinates (WBcel215) Overlapping transcripts
III: 2172442-2172556 [+]
sense
Y48G9A.3 ; Y48G9A.3; intron 11
Y48G9A.3 ; Y48G9A.3; intron 11
Y48G9A.3 ; Y48G9A.3; intron 11
Clustered miRNAs
< 10kb from cel-mir-229
cel-mir-229 III: 2172442-2172556 [+]
cel-mir-64 III: 2172838-2172947 [+]
cel-mir-65 III: 2172992-2173091 [+]
cel-mir-66 III: 2173098-2173196 [+]

Mature sequence cel-miR-229-5p

Accession MIMAT0000284
Previous IDs cel-miR-229
Sequence

8 -  

aaugacacugguuaucuuuuccaucg

 - 33

Get sequence
Deep sequencing 5248 reads, 6 experiments
Evidence experimental; cloned [1-3], Northern [1], Solexa [4], CLIPseq [5]
Validated targets
Predicted targets

Mature sequence cel-miR-229-3p

Accession MIMAT0015112
Previous IDs cel-miR-229*
Sequence

88 -  

agaaagguaucgggugucauag

 - 109

Get sequence
Deep sequencing 452 reads, 6 experiments
Evidence experimental; CLIPseq [5]
Predicted targets

References

1
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
2
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
3
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
4
PMID:19460142 "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development" Kato M, de Lencastre A, Pincus Z, Slack FJ Genome Biol. 10:R54(2009).
5
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).