Stem-loop sequence cel-mir-229

Accession

MI0000304 (change log)

Description

Caenorhabditis elegans miR-229 stem-loop

Literature search

3 open access papers mention cel-mir-229
(11 sentences)

Stem-loop

          a        g u        cca    ggaaugccccccauugauuuuuuc 
5' cgccggc augacacu g uaucuuuu   ucgu                        c
   ||||||| |||||||| | ||||||||   ||||                         
3' gcggccg uacugugg c auggaaag   agca                        c
          a        g u        ---    aagguuaaaaaaggggggcuuuuc 

Deep sequencing

133092 reads, 2.08e+03 reads per million, 17 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

The extents of the dominant mature miRNA species are adjusted here in accordance with a large scale cloning and sequencing study [3].

Genome context

• Coordinates (WBcel235; GCA_000002985.3): chrIII: 2172452-2172566 [+]
• Overlapping transcripts:

  sense

  Y48G9A.3 ; Y48G9A.3; intron 11

Clustered miRNAs

< 10kb from cel-mir-229

• cel-mir-229: chrIII: 2172452-2172566 [+]
• cel-mir-64: chrIII: 2172848-2172957 [+]
• cel-mir-65: chrIII: 2173002-2173101 [+]
• cel-mir-66: chrIII: 2173108-2173206 [+]

Database links

• RNAcentral:URS0000347558_6239
• miRBase Tracker:MI0000304

Mature sequence cel-miR-229-5p

• Accession: MIMAT0000284
• Previous IDs: cel-miR-229
• Sequence: 8 - aaugacacugguuaucuuuuccaucg - 33
• Deep sequencing: 51771 reads, 17 experiments
• Evidence: experimental; cloned [1-2], Northern [1], 454 [3], Illumina [4], CLIPseq [5]
• Database links:
  • RNAcentral:URS0000466DE6_6239
• Predicted targets:
  • TargetScanWorm:cel-miR-229
  • microrna.org:cel-miR-229-5p

Mature sequence cel-miR-229-3p

• Accession: MIMAT0015112
• Previous IDs: cel-miR-229*
• Sequence: 88 - agaaagguaucgggugucauag - 109
• Deep sequencing: 81303 reads, 17 experiments
• Evidence: experimental; CLIPseq [5]
• Database links:
  • RNAcentral:URS000010A74A_6239
• Predicted targets:
  • microrna.org:cel-miR-229-3p

References

1. PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
2. PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
3. PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
4. PMID:19460142 "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development" Kato M, de Lencastre A, Pincus Z, Slack FJ Genome Biol. 10:R54(2009).
5. PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).