Stem-loop sequence cel-mir-228

Accession MI0000303
Description Caenorhabditis elegans miR-228 stem-loop
Gene family MIPF0000292; mir-228
Stem-loop 
-----       -        a    c    c    a   a   -  aug a 
     ccuuauc ccguucgc augg acug auga uuc cgg cu   c u
     ||||||| |||||||| |||| |||| |||| ||| ||| ||   | a
     ggaguag ggcaggcg uacc uggc uacu agg gcc ga   g a
uaauu       u        a    a    a    -   c   a  -ca c
Get sequence
Deep sequencing
2676 reads, 6 experiments
Comments

This precursor sequence was predicted by comparative computational approaches [1,2]. Northern blotting confirmed that the strand containing the predicted miR is predominantly expressed, and the 5' and 3' ends were confirmed later [4].

Genome context
Coordinates (WBcel215) Overlapping transcripts
IV: 5562016-5562113 [+]
intergenic
Clustered miRNAs
< 10kb from cel-mir-228
cel-mir-228 IV: 5562016-5562113 [+]
cel-mir-790 IV: 5566413-5566482 [+]
Database links

Mature sequence cel-miR-228-5p

Accession MIMAT0000283
Previous IDs cel-miR-228
Sequence

16 -  

aauggcacugcaugaauucacgg

 - 38

Get sequence
Deep sequencing 2637 reads, 6 experiments
Evidence experimental; cloned [1,4], Northern [1,3], PCR [3], Solexa [5,7], CLIPseq [6]
Validated targets
Predicted targets

Mature sequence cel-miR-228-3p

Accession MIMAT0020327
Previous IDs cel-miR-228*
Sequence

58 -  

gcggaucauacgguaccauagc

 - 79

Get sequence
Deep sequencing 36 reads, 3 experiments
Evidence experimental; Solexa [7]
Predicted targets

References

1
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
2
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
3
PMID:12769849 "Computational and experimental identification of C. elegans microRNAs" Grad Y, Aach J, Hayes GD, Reinhart BJ, Church GM, Ruvkun G, Kim J Mol Cell. 11:1253-1263(2003).
4
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
5
PMID:19460142 "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development" Kato M, de Lencastre A, Pincus Z, Slack FJ Genome Biol. 10:R54(2009).
6
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
7
PMID:21307183 "Improved annotation of C. elegans microRNAs by deep sequencing reveals structures associated with processing by Drosha and Dicer" Warf MB, Johnson WE, Bass BL RNA. 17:563-577(2011).