Stem-loop sequence cel-mir-124

Accession

MI0000302

Description

Caenorhabditis elegans miR-124 stem-loop

Gene family

MIPF0000021; mir-124

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-124_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

The miR-124 microRNA precursor is a small non-coding RNA molecule that has been identified in flies (MI0000373), nematode worms (MI0000302), mouse (MI0000150) and human (MI0000443). The mature ~21 nucleotide microRNAs are processed from hairpin precursor sequences by the Dicer enzyme, and in this case originates from the 3' arm. miR-124 has been found to be the most abundant microRNA expressed in neuronal cells. Experiments to alter expression of miR-124 in neural cells did not appear to affect differentiation.

Stem-loop

gu    - -uu     c      g    cua   a       ----    au 
  ccca c   gucau uggcau cacc   gug cuuuagu    ggac  c
  |||| |   ||||| |||||| ||||   ||| |||||||    ||||   
  gggu g   cggug accgua gugg   cac ggaauca    ucug  u
--    a uac     c      a    -cg   -       accu    aa 

Deep sequencing

5221 reads, 6 experiments

Genome context

• Coordinates (WBcel215): IV: 11871715-11871810 [+]
• Overlapping transcripts:

  sense

  C29E6.2 ; C29E6.2; intron 5

  C29E6.2 ; C29E6.2; intron 5

  C29E6.2 ; C29E6.2; intron 5

  antisense

  C29E6.8 ; C29E6.8; exon 1

  C29E6.8 ; C29E6.8; exon 1

  C29E6.8 ; C29E6.8; exon 1

Database links

• WORMBASE:C29E6/8322-8417

Mature sequence cel-miR-124-5p

• Accession: MIMAT0015111
• Previous IDs: cel-miR-124*
• Sequence: 18 - gcaugcacccuagugacuuuagu - 40
• Deep sequencing: 10 reads, 2 experiments
• Evidence: experimental; CLIPseq [5]
• Predicted targets:
  • MICRORNA.ORG:cel-miR-124-5p
  • RNA22-CEL:cel-miR-124-5p

Mature sequence cel-miR-124-3p

• Accession: MIMAT0000282
• Previous IDs: cel-miR-124
• Sequence: 61 - uaaggcacgcggugaaugcca - 81
• Deep sequencing: 5211 reads, 6 experiments
• Evidence: experimental; cloned [1,3], Northern [1], Solexa [4], CLIPseq [5]
• Validated targets:
  • TARBASE:cel-miR-124-3p
• Predicted targets:
  • MICRORNA.ORG:cel-miR-124-3p
  • RNA22-CEL:cel-miR-124-3p
  • TARGETSCAN-WORM:cel-miR-124

References

1. PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
2. PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
3. PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
4. PMID:19460142 "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development" Kato M, de Lencastre A, Pincus Z, Slack FJ Genome Biol. 10:R54(2009).
5. PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).