Stem-loop sequence cel-mir-124

Accession MI0000302
Description Caenorhabditis elegans miR-124 stem-loop
Gene family MIPF0000021; mir-124
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-124_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-124 microRNA precursor is a small non-coding RNA molecule that has been identified in flies (MI0000373), nematode worms (MI0000302), mouse (MI0000150) and human (MI0000443). The mature ~21 nucleotide microRNAs are processed from hairpin precursor sequences by the Dicer enzyme, and in this case originates from the 3' arm. miR-124 has been found to be the most abundant microRNA expressed in neuronal cells. Experiments to alter expression of miR-124 in neural cells did not appear to affect differentiation.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
gu    - -uu     c      g    cua   a       ----    au 
  ccca c   gucau uggcau cacc   gug cuuuagu    ggac  c
  |||| |   ||||| |||||| ||||   ||| |||||||    ||||   
  gggu g   cggug accgua gugg   cac ggaauca    ucug  u
--    a uac     c      a    -cg   -       accu    aa 
Get sequence
Deep sequencing
5221 reads, 6 experiments
Genome context
Coordinates (WBcel215) Overlapping transcripts
IV: 11871715-11871810 [+]
sense
C29E6.2 ; C29E6.2; intron 5
C29E6.2 ; C29E6.2; intron 5
C29E6.2 ; C29E6.2; intron 5
antisense
C29E6.8 ; C29E6.8; exon 1
C29E6.8 ; C29E6.8; exon 1
C29E6.8 ; C29E6.8; exon 1
Database links

Mature sequence cel-miR-124-5p

Accession MIMAT0015111
Previous IDs cel-miR-124*
Sequence

18 - 

gcaugcacccuagugacuuuagu

 - 40

Get sequence
Deep sequencing 10 reads, 2 experiments
Evidence experimental; CLIPseq [5]
Predicted targets

Mature sequence cel-miR-124-3p

Accession MIMAT0000282
Previous IDs cel-miR-124
Sequence

61 - 

uaaggcacgcggugaaugcca

 - 81

Get sequence
Deep sequencing 5211 reads, 6 experiments
Evidence experimental; cloned [1,3], Northern [1], Solexa [4], CLIPseq [5]
Validated targets
Predicted targets

References

1
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
2
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
3
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
4
5
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).