Stem-loop sequence hsa-mir-224

AccessionMI0000301 (change log)
Symbol HGNC:MIR224
DescriptionHomo sapiens miR-224 stem-loop
Gene family MIPF0000088; mir-224
Literature search

123 open access papers mention hsa-mir-224
(840 sentences)

Stem-loop
          ca         u   u      a u   ug  u 
5' gggcuuu  agucacuag ggu ccguuu g aga  au g
   |||||||  ||||||||| ||| |||||| | |||  || u
3' cccgaaa  ucagugauc ccg gguaaa c uuu  ua g
          ca         -   u      a -   gu  c 
Get sequence
Deep sequencing
80807 reads, 238 reads per million, 148 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 151958578-151958658 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-224
hsa-mir-452chrX: 151959628-151959712 [-]
hsa-mir-224chrX: 151958578-151958658 [-]
Database links

Mature sequence hsa-miR-224-5p

Accession MIMAT0000281
Previous IDshsa-miR-224
Sequence

7 - 

ucaagucacuagugguuccguuuag

 - 31

Get sequence
Deep sequencing74998 reads, 147 experiments
Evidence experimental; cloned [1-4]
Database links
Predicted targets

Mature sequence hsa-miR-224-3p

Accession MIMAT0009198
Previous IDshsa-miR-224*
Sequence

53 - 

aaaauggugcccuagugacuaca

 - 75

Get sequence
Deep sequencing5757 reads, 111 experiments
Evidence experimental; qRT-PCR [5], 454 [6]
Database links
Predicted targets

References

1
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
2
PMID:15891114 "Clustering and conservation patterns of human microRNAs" Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H Nucleic Acids Res. 33:2697-2706(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
5
PMID:19015728 "MicroRNA expression patterns and function in endodermal differentiation of human embryonic stem cells" Tzur G, Levy A, Meiri E, Barad O, Spector Y, Bentwich Z, Mizrahi L, Katzenellenbogen M, Ben-Shushan E, Reubinoff BE, Galun E PLoS One. 3:e3726(2008).
6
PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).