Stem-loop sequence hsa-mir-224

Accession MI0000301
Symbol HGNC:MIR224
Description Homo sapiens miR-224 stem-loop
Gene family MIPF0000088; mir-224
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled MiR-224. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-224 is a family of microRNA precursors found in mammals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
       ca         u   u      a u   ug  u 
gggcuuu  agucacuag ggu ccguuu g aga  au g
|||||||  ||||||||| ||| |||||| | |||  || u
cccgaaa  ucagugauc ccg gguaaa c uuu  ua g
       ca         -   u      a -   gu  c 
Get sequence
Deep sequencing
959 reads, 24 experiments
Comments

This miR was identified and ends mapped by cloning from Weri cells in human. The sequence maps to chromosome X. An erratum corrected the originally published name miR-175 to miR-224. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chrX: 151127050-151127130 [-]
sense
OTTHUMT00000060909 ; GABRE-007; exon 1
OTTHUMT00000060909 ; GABRE-007; exon 1
OTTHUMT00000060909 ; GABRE-007; exon 1
OTTHUMT00000346524 ; GABRE-013; exon 3
OTTHUMT00000346524 ; GABRE-013; exon 3
OTTHUMT00000060903 ; GABRE-001; intron 6
OTTHUMT00000060904 ; GABRE-002; intron 6
OTTHUMT00000060903 ; GABRE-001; intron 6
OTTHUMT00000060904 ; GABRE-002; intron 6
OTTHUMT00000060903 ; GABRE-001; intron 6
OTTHUMT00000060904 ; GABRE-002; intron 6
OTTHUMT00000060907 ; GABRE-005; intron 7
OTTHUMT00000060907 ; GABRE-005; intron 7
OTTHUMT00000060907 ; GABRE-005; intron 7
ENST00000486255 ; GABRE-007; exon 1
ENST00000486255 ; GABRE-007; exon 1
ENST00000486255 ; GABRE-007; exon 1
ENST00000476016 ; GABRE-013; exon 3
ENST00000476016 ; GABRE-013; exon 3
ENST00000370328 ; GABRE-001; intron 6
ENST00000370325 ; GABRE-002; intron 6
ENST00000370328 ; GABRE-001; intron 6
ENST00000370325 ; GABRE-002; intron 6
ENST00000370328 ; GABRE-001; intron 6
ENST00000370325 ; GABRE-002; intron 6
ENST00000441219 ; GABRE-005; intron 7
ENST00000393914 ; GABRE-201; intron 7
ENST00000441219 ; GABRE-005; intron 7
ENST00000393914 ; GABRE-201; intron 7
ENST00000441219 ; GABRE-005; intron 7
ENST00000393914 ; GABRE-201; intron 7
Clustered miRNAs
< 10kb from hsa-mir-224
hsa-mir-452 chrX: 151128100-151128184 [-]
hsa-mir-224 chrX: 151127050-151127130 [-]
Database links

Mature sequence hsa-miR-224-5p

Accession MIMAT0000281
Previous IDs hsa-miR-224
Sequence

8 - 

caagucacuagugguuccguu

 - 28

Get sequence
Deep sequencing 949 reads, 20 experiments
Evidence experimental; cloned [1-4]
Validated targets
Predicted targets

Mature sequence hsa-miR-224-3p

Accession MIMAT0009198
Previous IDs hsa-miR-224*
Sequence

53 - 

aaaauggugcccuagugacuaca

 - 75

Get sequence
Deep sequencing 10 reads, 6 experiments
Evidence experimental; qRT-PCR [5], 454 [6]
Predicted targets

References

1
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
2
PMID:15891114 "Clustering and conservation patterns of human microRNAs" Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H Nucleic Acids Res. 33:2697-2706(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
5
PMID:19015728 "MicroRNA expression patterns and function in endodermal differentiation of human embryonic stem cells" Tzur G, Levy A, Meiri E, Barad O, Spector Y, Bentwich Z, Mizrahi L, Katzenellenbogen M, Ben-Shushan E, Reubinoff BE, Galun E PLoS One. 3:e3726(2008).
6
PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).