Stem-loop sequence hsa-mir-223

AccessionMI0000300 (change log)
Symbol HGNC:MIR223
DescriptionHomo sapiens miR-223 stem-loop
Gene family MIPF0000067; mir-223
Literature search

400 open access papers mention hsa-mir-223
(2675 sentences)

Stem-loop
   c    ccuccu   -     a    cc u              gaguug       cau 
5'  cugg      gca gugcc cgcu  g guauuugacaagcu      gacacuc   g
    ||||      ||| ||||| ||||  | ||||||||||||||      |||||||   u
3'  gacc      cgu cacgg guga  c cauaaacuguuuga      cugugag   g
   -    ---auu   a     c    ac c              ------       aug 
Get sequence
Deep sequencing
180865 reads, 1.04e+03 reads per million, 142 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. Landgraf et al. confirm expression in human [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 66018870-66018979 [+]
intergenic
Database links

Mature sequence hsa-miR-223-5p

Accession MIMAT0004570
Previous IDshsa-miR-223*
Sequence

26 - 

cguguauuugacaagcugaguu

 - 47

Get sequence
Deep sequencing13274 reads, 105 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-223-3p

Accession MIMAT0000280
Previous IDshsa-miR-223
Sequence

68 - 

ugucaguuugucaaauacccca

 - 89

Get sequence
Deep sequencing167585 reads, 139 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).