Stem-loop sequence hsa-mir-223

Accession MI0000300
Symbol HGNC:MIR223
Description Homo sapiens miR-223 stem-loop
Gene family MIPF0000067; mir-223
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-223. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology MicroRNA-223 (miR-223) is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms. miR-223 is a hematopoietic specific microRNA with crucial functions in myeloid lineage development. It plays an essential role in promoting granulocytic differentiation while also being associated with the suppression of erythrocytic differentiation. miR-223 is commonly repressed in hepatocellular carcinoma and leukemia. Higher expression levels of miRNA-223 are associated with extranodal marginal-zone lymphoma of mucosa-associated lymphoid tissue of the stomach and recurrent ovarian cancer. In some cancers the microRNA-223 down-regulation is correlated with higher tumor burden, disease aggressiveness, and poor prognostic factors. MicroRNA-223 is also associated with rheumatoid arthritis, sepsis, type 2 diabetes, and hepatic ischemia.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
c    ccuccu   -     a    cc u              gaguug       cau 
 cugg      gca gugcc cgcu  g guauuugacaagcu      gacacuc   g
 ||||      ||| ||||| ||||  | ||||||||||||||      |||||||   u
 gacc      cgu cacgg guga  c cauaaacuguuuga      cugugag   g
-    ---auu   a     c    ac c              ------       aug 
Get sequence
Deep sequencing
1586 reads, 27 experiments
Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. Landgraf et al. confirm expression in human [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chrX: 65238712-65238821 [+]
sense
ENST00000540516 ; AL034397.1-201; exon 2
ENST00000538676 ; AL034397.1-202; exon 3
Database links

Mature sequence hsa-miR-223-5p

Accession MIMAT0004570
Previous IDs hsa-miR-223*
Sequence

26 - 

cguguauuugacaagcugaguu

 - 47

Get sequence
Deep sequencing 4 reads, 2 experiments
Evidence experimental; cloned [2]
Predicted targets

Mature sequence hsa-miR-223-3p

Accession MIMAT0000280
Previous IDs hsa-miR-223
Sequence

68 - 

ugucaguuugucaaauacccca

 - 89

Get sequence
Deep sequencing 1581 reads, 25 experiments
Evidence experimental; cloned [2]
Validated targets
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).