Stem-loop sequence hsa-mir-222

AccessionMI0000299
Symbol HGNC:MIR222
DescriptionHomo sapiens miR-222 stem-loop
Gene family MIPF0000051; mir-221
Stem-loop
   gcu           uaggua  c   au              -     auc   ucuu 
5'    gcuggaaggug      cc uca  ggcucaguagccag uguag   cug    u
      |||||||||||      || |||  |||||||||||||| |||||   |||    c
3'    cgaucuucuac      gg agu  cugggucaucgguc acauc   gac    g
   --u           ------  u   cu              u     gac   uaau 
Get sequence
Deep sequencing
56398 reads, 5.15e+03 reads per million, 75 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR was validated in zebrafish, and the ends mapped by cloning. Subsequent cloning studies have also verified the expression of miR-222 in human ES cells. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chrX: 45747015-45747124 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-222
hsa-mir-222chrX: 45747015-45747124 [-]
hsa-mir-221chrX: 45746157-45746266 [-]
Database links

Mature sequence hsa-miR-222-5p

Accession MIMAT0004569
Previous IDshsa-miR-222*
Sequence

31 - 

cucaguagccaguguagauccu

 - 52

Get sequence
Deep sequencing281 reads, 34 experiments
Evidence experimental; cloned [4]
Predicted targets

Mature sequence hsa-miR-222-3p

Accession MIMAT0000279
Previous IDshsa-miR-222
Sequence

69 - 

agcuacaucuggcuacugggu

 - 89

Get sequence
Deep sequencing24920 reads, 69 experiments
Evidence experimental; cloned [2-5], Northern [2]
Validated targets
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
3
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).