Stem-loop sequence hsa-mir-221

Accession

MI0000298

Symbol

HGNC:MIR221

Description

Homo sapiens miR-221 stem-loop

Gene family

MIPF0000051; mir-221

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-221_microRNA. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

In molecular biology mir-221 microRNA (and it's paralogue, mir-222) is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms. mir-221 is an oncogenic microRNA. It targets CD117, which then prevents cell migration and proliferation in endothelial cells. miR-221 is known as an anti angiogenic miRNA. Recent important studies have reported that miR-221 is also involved in induction of angiogenesis. RNA induced Silencing Complex (RISC) proteins SND1 and AEG-1 induces miR-221 expression in Liver cancer. In liver cancer miR-221 induces the tumor angiogenesis.

Stem-loop

-u     ----       cugg   a    -  ug   u         auuu    -   c 
  gaaca    uccaggu    ggc ugaa cc  gca acaauguag    cugu guu g
  |||||    |||||||    ||| |||| ||  ||| |||||||||    |||| ||| u
  cuugu    aggucca    ucg acuu gg  cgu uguuacauc    gaca cgg u
cu     acaa       ----   g    u  gu   c         ----    a   a 

Deep sequencing

311841 reads, 34 experiments

Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and later validated in human HL-60 leukemia cells [2].

Genome context

• Coordinates (GRCh37.p5): chrX: 45605585-45605694 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from hsa-mir-221

• hsa-mir-222: chrX: 45606421-45606530 [-]
• hsa-mir-221: chrX: 45605585-45605694 [-]

Database links

• EMBL: AJ550425;HSA550425
• ENTREZGENE: 407006;MIR221
• HGNC: 31601;MIR221

Mature sequence hsa-miR-221-5p

• Accession: MIMAT0004568
• Previous IDs: hsa-miR-221*
• Sequence: 25 - accuggcauacaauguagauuu - 46
• Deep sequencing: 24864 reads, 22 experiments
• Evidence: experimental; cloned [3]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-221-5p
  • MICRORNA.ORG:hsa-miR-221-5p
  • MIRDB:hsa-miR-221-5p
  • RNA22-HSA:hsa-miR-221-5p
  • TARGETMINER:hsa-miR-221-5p
  • PICTAR-VERT:hsa-miR-221

Mature sequence hsa-miR-221-3p

• Accession: MIMAT0000278
• Previous IDs: hsa-miR-221
• Sequence: 65 - agcuacauugucugcuggguuuc - 87
• Deep sequencing: 286975 reads, 33 experiments
• Evidence: experimental; cloned [2-4], Solexa [5]
• Validated targets:
  • TARBASE:hsa-miR-221-3p
• Predicted targets:
  • DIANA-MICROT:hsa-miR-221-3p
  • MICRORNA.ORG:hsa-miR-221-3p
  • MIRDB:hsa-miR-221-3p
  • RNA22-HSA:hsa-miR-221-3p
  • TARGETMINER:hsa-miR-221-3p
  • TARGETSCAN-VERT:hsa-miR-221
  • PICTAR-VERT:hsa-miR-221

References

1. PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2. PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
5. PMID:20158877 "Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha" Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V BMC Genomics. 11 Suppl 1:S6(2010).