Stem-loop sequence hsa-mir-221

AccessionMI0000298 (change log)
Symbol HGNC:MIR221
DescriptionHomo sapiens miR-221 stem-loop
Gene family MIPF0000051; mir-221
Literature search

572 open access papers mention hsa-mir-221
(4090 sentences)

Stem-loop
   -u     ----       cugg   a    -  ug   u         auuu    -   c 
5'   gaaca    uccaggu    ggc ugaa cc  gca acaauguag    cugu guu g
     |||||    |||||||    ||| |||| ||  ||| |||||||||    |||| ||| u
3'   cuugu    aggucca    ucg acuu gg  cgu uguuacauc    gaca cgg u
   cu     acaa       ----   g    u  gu   c         ----    a   a 
Get sequence
Deep sequencing
2336450 reads, 4.32e+03 reads per million, 159 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and later validated in human HL-60 leukemia cells [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 45746157-45746266 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-221
hsa-mir-222chrX: 45747015-45747124 [-]
hsa-mir-221chrX: 45746157-45746266 [-]
Database links

Mature sequence hsa-miR-221-5p

Accession MIMAT0004568
Previous IDshsa-miR-221*
Sequence

25 - 

accuggcauacaauguagauuu

 - 46

Get sequence
Deep sequencing159083 reads, 151 experiments
Evidence experimental; cloned [3]
Database links
Predicted targets

Mature sequence hsa-miR-221-3p

Accession MIMAT0000278
Previous IDshsa-miR-221
Sequence

65 - 

agcuacauugucugcuggguuuc

 - 87

Get sequence
Deep sequencing2177254 reads, 159 experiments
Evidence experimental; cloned [2-4], Illumina [5]
Database links
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
5