Stem-loop sequence hsa-mir-218-2

Accession MI0000295
Symbol HGNC:MIR218-2
Description Homo sapiens miR-218-2 stem-loop
Gene family MIPF0000026; mir-218
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-218_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-218 microRNA precursor is a small non-coding RNA that regulates gene expression by antisense binding. miR-218 appears to be a vertebrate specific microRNA and has now been predicted and experimentally confirmed in a wide range of vertebrate species. The extents of the hairpin precursors are not known. In this case the mature sequence in excised from the 5'arm of the hairpin. miR-218, along with miR-585, has been found to be silenced by DNA methylation in oral squamous cell carcinoma. It is also downregulated in Nasopharyngeal carcinoma, with artificially-induced expression serving to slow tumour growth. miR-218 has also been found to have tumour suppressing qualities in bladder cancer cells.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop 
gac   --uc  u    g       uuu         cu        gguggaacga  g 
   cag    gc gcgg gcuuucc   gugcuugau  aaccaugu          ug a
   |||    || |||| |||||||   |||||||||  ||||||||          ||  
   guc    cg ugcc cgaaagg   cacgaacug  uugguaca          gc a
-ac   cucu  -    a       cgc         uc        --------ag  a
Get sequence
Deep sequencing
1042 reads, 30 experiments
Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. Landgraf et al. confirm expression in human [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr5: 168195151-168195260 [-]
sense
OTTHUMT00000371506 ; SLIT3-004; intron 4
OTTHUMT00000371506 ; SLIT3-004; intron 4
OTTHUMT00000371506 ; SLIT3-004; intron 4
OTTHUMT00000252792 ; SLIT3-001; intron 14
OTTHUMT00000371504 ; SLIT3-002; intron 14
OTTHUMT00000252792 ; SLIT3-001; intron 14
OTTHUMT00000371504 ; SLIT3-002; intron 14
OTTHUMT00000252792 ; SLIT3-001; intron 14
OTTHUMT00000371504 ; SLIT3-002; intron 14
ENST00000519486 ; SLIT3-004; intron 4
ENST00000519486 ; SLIT3-004; intron 4
ENST00000519486 ; SLIT3-004; intron 4
ENST00000519560 ; SLIT3-001; intron 14
ENST00000332966 ; SLIT3-002; intron 14
ENST00000404867 ; SLIT3-201; intron 14
ENST00000519560 ; SLIT3-001; intron 14
ENST00000332966 ; SLIT3-002; intron 14
ENST00000404867 ; SLIT3-201; intron 14
ENST00000519560 ; SLIT3-001; intron 14
ENST00000332966 ; SLIT3-002; intron 14
ENST00000404867 ; SLIT3-201; intron 14
Database links

Mature sequence hsa-miR-218-5p

Accession MIMAT0000275
Previous IDs hsa-miR-218
Sequence

25 -  

uugugcuugaucuaaccaugu

 - 45

Get sequence
Deep sequencing 1343 reads, 29 experiments
Evidence experimental; cloned [2-3]
Validated targets
Predicted targets

Mature sequence hsa-miR-218-2-3p

Accession MIMAT0004566
Previous IDs hsa-miR-218-2*
Sequence

67 -  

caugguucugucaagcaccgcg

 - 88

Get sequence
Deep sequencing 1 reads, 1 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).