Stem-loop sequence hsa-mir-218-2

AccessionMI0000295 (change log)
Symbol HGNC:MIR218-2
DescriptionHomo sapiens miR-218-2 stem-loop
Gene family MIPF0000026; mir-218
Literature search

177 open access papers mention hsa-mir-218-2
(1065 sentences)

Stem-loop
   gac   --uc  u    g       uuu         cu        gguggaacga  g 
5'    cag    gc gcgg gcuuucc   gugcuugau  aaccaugu          ug a
      |||    || |||| |||||||   |||||||||  ||||||||          ||  
3'    guc    cg ugcc cgaaagg   cacgaacug  uugguaca          gc a
   -ac   cucu  -    a       cgc         uc        --------ag  a 
Get sequence
Deep sequencing
349966 reads, 1.08e+03 reads per million, 145 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. Landgraf et al. confirm expression in human [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr5: 168768146-168768255 [-]
intergenic
Database links

Mature sequence hsa-miR-218-5p

Accession MIMAT0000275
Previous IDshsa-miR-218
Sequence

25 - 

uugugcuugaucuaaccaugu

 - 45

Get sequence
Deep sequencing715721 reads, 142 experiments
Evidence experimental; cloned [2-3]
Database links
Predicted targets

Mature sequence hsa-miR-218-2-3p

Accession MIMAT0004566
Previous IDshsa-miR-218-2*
Sequence

67 - 

caugguucugucaagcaccgcg

 - 88

Get sequence
Deep sequencing1597 reads, 69 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).