|
miRBase |
|
Stem-loop sequence MI0000295 |
|||||
| Accession | MI0000295 | ||||
| ID | hsa-mir-218-2 | ||||
| Symbol | HGNC:MIR218-2 | ||||
| Description | Homo sapiens miR-218-2 stem-loop | ||||
| Stem-loop |
gac --uc u g uuu cu gguggaacga g cag gc gcgg gcuuucc gugcuugau aaccaugu ug a ||| || |||| ||||||| ||||||||| |||||||| || guc cg ugcc cgaaagg cacgaacug uugguaca gc a -ac cucu - a cgc uc --------ag a |
||||
| Comments |
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. Landgraf et al. confirm expression in human [2]. |
||||
| Genome context |
View flanking features |
||||
| Database links | |||||
| Gene family |
MIPF0000026; mir-218 |
||||
Mature sequence MIMAT0000275 |
|
| Accession | MIMAT0000275 |
| ID | hsa-miR-218 |
| Sequence |
25 - uugugcuugaucuaaccaugu - 45 |
| Evidence | experimental; cloned [2-3] |
| Predicted targets |
|
Minor miR* sequence MIMAT0004566 |
|
| Accession | MIMAT0004566 |
| ID | hsa-miR-218-2* |
| Sequence |
67 - caugguucugucaagcaccgcg - 88 |
| Evidence | experimental; cloned [2] |
| Predicted targets |
|
References |
|
| 1 |
"Vertebrate microRNA genes"
Science. 299:1540(2003).
|
| 2 |
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 3 |
"Patterns of known and novel small RNAs in human cervical cancer"
Cancer Res. 67:6031-6043(2007).
|