Stem-loop sequence hsa-mir-218-1

Accession MI0000294
Symbol HGNC:MIR218-1
Description Homo sapiens miR-218-1 stem-loop
Gene family MIPF0000026; mir-218
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-218_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-218 microRNA precursor is a small non-coding RNA that regulates gene expression by antisense binding. miR-218 appears to be a vertebrate specific microRNA and has now been predicted and experimentally confirmed in a wide range of vertebrate species. The extents of the hairpin precursors are not known. In this case the mature sequence in excised from the 5'arm of the hairpin. miR-218, along with miR-585, has been found to be silenced by DNA methylation in oral squamous cell carcinoma. It is also downregulated in Nasopharyngeal carcinoma, with artificially-induced expression serving to slow tumour growth. miR-218 has also been found to have tumour suppressing qualities in bladder cancer cells.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop 
-   au  u  a   a   u      u         cu        gg    gag 
 gug  aa gu gcg gau uucugu gugcuugau  aaccaugu  uugc   g
 |||  || || ||| ||| |||||| |||||||||  ||||||||  ||||   u
 cau  uu cg cgc cug aaggua cacgaacug  uugguaca  aaug   a
a   cu  -  a   a   c      c         cc        -a    agu
Get sequence
Deep sequencing
324 reads, 24 experiments
Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. Landgraf et al. later verified the expression of miR-218 in human [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr4: 20529898-20530007 [+]
sense
OTTHUMT00000359841 ; SLIT2-002; intron 14
OTTHUMT00000359841 ; SLIT2-002; intron 14
OTTHUMT00000359841 ; SLIT2-002; intron 14
OTTHUMT00000250396 ; SLIT2-001; intron 15
OTTHUMT00000359842 ; SLIT2-003; intron 15
OTTHUMT00000250396 ; SLIT2-001; intron 15
OTTHUMT00000359842 ; SLIT2-003; intron 15
OTTHUMT00000250396 ; SLIT2-001; intron 15
OTTHUMT00000359842 ; SLIT2-003; intron 15
OTTHUMT00000359843 ; SLIT2-004; intron 16
OTTHUMT00000359843 ; SLIT2-004; intron 16
OTTHUMT00000359843 ; SLIT2-004; intron 16
ENST00000503823 ; SLIT2-002; intron 14
ENST00000382173 ; SLIT2-201; intron 14
ENST00000503823 ; SLIT2-002; intron 14
ENST00000382173 ; SLIT2-201; intron 14
ENST00000503823 ; SLIT2-002; intron 14
ENST00000504154 ; SLIT2-001; intron 15
ENST00000503837 ; SLIT2-003; intron 15
ENST00000504154 ; SLIT2-001; intron 15
ENST00000503837 ; SLIT2-003; intron 15
ENST00000504154 ; SLIT2-001; intron 15
ENST00000503837 ; SLIT2-003; intron 15
ENST00000273739 ; SLIT2-004; intron 16
ENST00000273739 ; SLIT2-004; intron 16
ENST00000273739 ; SLIT2-004; intron 16
Database links

Mature sequence hsa-miR-218-5p

Accession MIMAT0000275
Previous IDs hsa-miR-218
Sequence

25 -  

uugugcuugaucuaaccaugu

 - 45

Get sequence
Deep sequencing 1343 reads, 29 experiments
Evidence experimental; cloned [2-3]
Validated targets
Predicted targets

Mature sequence hsa-miR-218-1-3p

Accession MIMAT0004565
Previous IDs hsa-miR-218-1*
Sequence

68 -  

augguuccgucaagcaccaugg

 - 89

Get sequence
Deep sequencing 15 reads, 8 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).