Stem-loop sequence hsa-mir-217

Accession MI0000293
Symbol HGNC:MIR217
Description Homo sapiens miR-217 stem-loop
Gene family MIPF0000077; mir-217
Stem-loop 
aguauaauuauuacaua    uu     c c  a  c     c          u -   aag 
                 guuu  gaugu g ag ua ugcau aggaacugau g gau   a
                 ||||  ||||| | || || ||||| |||||||||| | |||    
                 caaa  cuacg c uc gu acgua uccuugacua c cug   a
--------------gaa    -u     a u  c  u     a          c a   acu
Get sequence
Deep sequencing
8 reads, 4 experiments
Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. The sequence maps to human chromosome 2. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr2: 56210102-56210211 [-]
sense
OTTHUMT00000324929 ; AC011306.2-001; intron 2
OTTHUMT00000324929 ; AC011306.2-001; intron 2
OTTHUMT00000324929 ; AC011306.2-001; intron 2
ENST00000446139 ; AC011306.2-001; intron 2
ENST00000446139 ; AC011306.2-001; intron 2
ENST00000446139 ; AC011306.2-001; intron 2
Clustered miRNAs
< 10kb from hsa-mir-217
hsa-mir-216a chr2: 56216085-56216194 [-]
hsa-mir-217 chr2: 56210102-56210211 [-]
Database links

Mature sequence hsa-miR-217

Accession MIMAT0000274
Sequence

35 -  

uacugcaucaggaacugauugga

 - 57

Get sequence
Deep sequencing 7 reads, 3 experiments
Evidence experimental; cloned [2]
Validated targets
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).