Stem-loop sequence hsa-mir-216a

Accession MI0000292
Previous IDs hsa-mir-216
Symbol HGNC:MIR216A
Description Homo sapiens miR-216a stem-loop
Gene family MIPF0000054; mir-216
Stem-loop
----  u     u   ----------     u         cu   a        ---a   u 
    ga ggcug gag          uuggc uaaucucag  ggc acugugag    ugu c
    || ||||| |||          ||||| |||||||||  ||| ||||||||    |||  
    cu ccgau cuu          aaucg auuaggguc  cug ugacacuc    aca a
agca  c     c   uaacgagaca     u         -u   g        ccua   u 
Get sequence
Deep sequencing
3 reads, 2 experiments
Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr2: 56216085-56216194 [-]
sense
OTTHUMT00000324929 ; AC011306.2-001; intron 2
OTTHUMT00000324929 ; AC011306.2-001; intron 2
OTTHUMT00000324929 ; AC011306.2-001; intron 2
ENST00000446139 ; AC011306.2-001; intron 2
ENST00000446139 ; AC011306.2-001; intron 2
ENST00000446139 ; AC011306.2-001; intron 2
Clustered miRNAs
< 10kb from hsa-mir-216a
hsa-mir-216a chr2: 56216085-56216194 [-]
hsa-mir-217 chr2: 56210102-56210211 [-]
Database links

Mature sequence hsa-miR-216a-5p

Accession MIMAT0000273
Previous IDs hsa-miR-216;hsa-miR-216a
Sequence

19 - 

uaaucucagcuggcaacuguga

 - 40

Get sequence
Deep sequencing 2 reads, 1 experiments
Evidence experimental; cloned [2], SOLiD [3]
Validated targets
Predicted targets

Mature sequence hsa-miR-216a-3p

Accession MIMAT0022844
Sequence

58 - 

ucacaguggucucugggauuau

 - 79

Get sequence
Deep sequencing 1 reads, 1 experiments
Evidence experimental; SOLiD [3]
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:22282338 "Deep-sequencing of endothelial cells exposed to hypoxia reveals the complexity of known and novel microRNAs" Voellenkle C, Rooij Jv, Guffanti A, Brini E, Fasanaro P, Isaia E, Croft L, David M, Capogrossi MC, Moles A, Felsani A, Martelli F RNA. 18:472-484(2012).