Stem-loop sequence hsa-mir-215

AccessionMI0000291 (change log)
Symbol HGNC:MIR215
DescriptionHomo sapiens miR-215 stem-loop
Gene family MIPF0000063; mir-192
Literature search

102 open access papers mention hsa-mir-215
(415 sentences)

Stem-loop
   aucauuca   a      ------      a a  a    -u   u          uaua 
5'         gaa ugguau      acagga a ug ccua  gaa ugacagacaa    g
           ||| ||||||      |||||| | || ||||  ||| ||||||||||    c
3'         cuu aucgug      ugucuu u ac ggau  cuu acugucuguu    u
   ------aa   c      ucagua      a a  c    uu   u          ugag 
Get sequence
Deep sequencing
883763 reads, 686 reads per million, 159 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. Landgraf et al. confirm expression in human [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 220117853-220117962 [-]
sense
OTTHUMT00000098802 ; SLC30A10-002; intron 1
ENST00000484239 ; SLC30A10-002; intron 1
ENST00000536446 ; SLC30A10-201; intron 1
Clustered miRNAs
< 10kb from hsa-mir-215
hsa-mir-194-1chr1: 220118157-220118241 [-]
hsa-mir-215chr1: 220117853-220117962 [-]
Database links

Mature sequence hsa-miR-215-5p

Accession MIMAT0000272
Sequence

27 - 

augaccuaugaauugacagac

 - 47

Get sequence
Deep sequencing883731 reads, 159 experiments
Evidence experimental; cloned [2], Illumina [3]
Database links
Predicted targets

Mature sequence hsa-miR-215-3p

Accession MIMAT0026476
Sequence

64 - 

ucugucauuucuuuaggccaaua

 - 86

Get sequence
Deep sequencing20 reads, 12 experiments
Evidence experimental; Illumina [3]
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).