Stem-loop sequence hsa-mir-215

Accession

MI0000291

Symbol

HGNC:MIR215

Description

Homo sapiens miR-215 stem-loop

Gene family

MIPF0000063; mir-192

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-192/215_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

The miR-192 microRNA precursor (homologous to miR-215), is a short non-coding RNA gene involved in gene regulation. miR-192 and miR-215 have now been predicted or experimentally confirmed in mouse and human. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 5' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. mir-192 and mir-215 are thought to be positive regulators of p53, a human tumour suppressor. They are also overexpressed in gastric cancer, and could potentially be used as biomarkers or therapeutic targets. It has also been suggested that mir-192 could be used as a biomarker for drug-induced liver damage.

Stem-loop

aucauuca   a      ------      a a  a    -u   u          uaua 
        gaa ugguau      acagga a ug ccua  gaa ugacagacaa    g
        ||| ||||||      |||||| | || ||||  ||| ||||||||||    c
        cuu aucgug      ugucuu u ac ggau  cuu acugucuguu    u
------aa   c      ucagua      a a  c    uu   u          ugag 

Deep sequencing

13052 reads, 31 experiments

Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. Landgraf et al. confirm expression in human [2].

Genome context

• Coordinates (GRCh37.p5): chr1: 220291195-220291304 [-]
• Overlapping transcripts:

  antisense

  OTTHUMT00000090763 ; IARS2-003; intron 1

  OTTHUMT00000090763 ; IARS2-003; intron 1

  OTTHUMT00000090763 ; IARS2-003; intron 1

  OTTHUMT00000090761 ; IARS2-001; intron 12

  OTTHUMT00000090761 ; IARS2-001; intron 12

  OTTHUMT00000090761 ; IARS2-001; intron 12

  ENST00000490891 ; IARS2-003; intron 1

  ENST00000490891 ; IARS2-003; intron 1

  ENST00000490891 ; IARS2-003; intron 1

  ENST00000366922 ; IARS2-001; intron 12

  ENST00000302637 ; IARS2-201; intron 12

  ENST00000366922 ; IARS2-001; intron 12

  ENST00000302637 ; IARS2-201; intron 12

  ENST00000366922 ; IARS2-001; intron 12

  ENST00000302637 ; IARS2-201; intron 12

Clustered miRNAs

< 10kb from hsa-mir-215

• hsa-mir-194-1: chr1: 220291499-220291583 [-]
• hsa-mir-215: chr1: 220291195-220291304 [-]

Database links

• EMBL: AJ550418;HSA550418
• ENTREZGENE: 406997;MIR215
• HGNC: 31592;MIR215

Mature sequence hsa-miR-215

• Accession: MIMAT0000272
• Sequence: 27 - augaccuaugaauugacagac - 47
• Deep sequencing: 13052 reads, 31 experiments
• Evidence: experimental; cloned [2]
• Validated targets:
  • MIRECORDS:hsa-miR-215
  • MIRTARBASE:hsa-miR-215
  • TARBASE:hsa-miR-215
• Predicted targets:
  • DIANA-MICROT:hsa-miR-215
  • MICRORNA.ORG:hsa-miR-215
  • MIRDB:hsa-miR-215
  • RNA22-HSA:hsa-miR-215
  • TARGETMINER:hsa-miR-215
  • TARGETSCAN-VERT:hsa-miR-215
  • PICTAR-VERT:hsa-miR-215

References

1. PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).