Stem-loop sequence hsa-mir-214

Accession

MI0000290

Symbol

HGNC:MIR214

Description

Homo sapiens miR-214 stem-loop

Gene family

MIPF0000062; mir-214

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled MiR-214. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

miR-214 is a family of microRNA precursors found in animals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC which effects RNA interference.

Stem-loop

ggccu      acaga           u          aca            aacau 
     ggcugg     guugucaugug cugccugucu   cuugcugugcag     c
     ||||||     ||||||||||| ||||||||||   ||||||||||||     c
     ccgacc     caacaguacac gacggacaga   ggacgacauguc     g
----u      -----           u          cac            cacuc 

Deep sequencing

576 reads, 27 experiments

Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Landgraf et al. confirm expression in human [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context

• Coordinates (GRCh37.p5): chr1: 172107938-172108047 [-]
• Overlapping transcripts:

  antisense

  OTTHUMT00000378444 ; DNM3-008; intron 13

  OTTHUMT00000378444 ; DNM3-008; intron 13

  OTTHUMT00000378444 ; DNM3-008; intron 13

  OTTHUMT00000084529 ; DNM3-001; intron 14

  OTTHUMT00000378443 ; DNM3-007; intron 14

  OTTHUMT00000084529 ; DNM3-001; intron 14

  OTTHUMT00000378443 ; DNM3-007; intron 14

  OTTHUMT00000084529 ; DNM3-001; intron 14

  OTTHUMT00000378443 ; DNM3-007; intron 14

  OTTHUMT00000084531 ; DNM3-003; intron 15

  OTTHUMT00000084531 ; DNM3-003; intron 15

  OTTHUMT00000084531 ; DNM3-003; intron 15

  ENST00000523513 ; DNM3-008; intron 13

  ENST00000523513 ; DNM3-008; intron 13

  ENST00000523513 ; DNM3-008; intron 13

  ENST00000367731 ; DNM3-001; intron 14

  ENST00000520906 ; DNM3-007; intron 14

  ENST00000358155 ; DNM3-201; intron 14

  ENST00000367731 ; DNM3-001; intron 14

  ENST00000520906 ; DNM3-007; intron 14

  ENST00000358155 ; DNM3-201; intron 14

  ENST00000367731 ; DNM3-001; intron 14

  ENST00000520906 ; DNM3-007; intron 14

  ENST00000358155 ; DNM3-201; intron 14

  ENST00000355305 ; DNM3-003; intron 15

  ENST00000359070 ; DNM3-202; intron 15

  ENST00000355305 ; DNM3-003; intron 15

  ENST00000359070 ; DNM3-202; intron 15

  ENST00000355305 ; DNM3-003; intron 15

Clustered miRNAs

< 10kb from hsa-mir-214

• hsa-mir-199a-2: chr1: 172113675-172113784 [-]
• hsa-mir-3120: chr1: 172107948-172108028 [+]
• hsa-mir-214: chr1: 172107938-172108047 [-]

Database links

• EMBL: AJ550417;HSA550417
• ENTREZGENE: 406996;MIR214
• HGNC: 31591;MIR214

Mature sequence hsa-miR-214-5p

• Accession: MIMAT0004564
• Previous IDs: hsa-miR-214*
• Sequence: 30 - ugccugucuacacuugcugugc - 51
• Deep sequencing: 51 reads, 4 experiments
• Evidence: experimental; cloned [2-3], Northern [3]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-214-5p
  • MICRORNA.ORG:hsa-miR-214-5p
  • MIRDB:hsa-miR-214-5p
  • RNA22-HSA:hsa-miR-214-5p
  • TARGETMINER:hsa-miR-214-5p
  • PICTAR-VERT:hsa-miR-214

Mature sequence hsa-miR-214-3p

• Accession: MIMAT0000271
• Previous IDs: hsa-miR-214
• Sequence: 71 - acagcaggcacagacaggcagu - 92
• Deep sequencing: 515 reads, 24 experiments
• Evidence: experimental; cloned [2]
• Validated targets:
  • TARBASE:hsa-miR-214-3p
• Predicted targets:
  • DIANA-MICROT:hsa-miR-214-3p
  • MICRORNA.ORG:hsa-miR-214-3p
  • MIRDB:hsa-miR-214-3p
  • RNA22-HSA:hsa-miR-214-3p
  • TARGETMINER:hsa-miR-214-3p
  • TARGETSCAN-VERT:hsa-miR-214
  • PICTAR-VERT:hsa-miR-214

References

1. PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:18230126 "New miRNAs cloned from neuroblastoma" Afanasyeva EA, Hotz-Wagenblatt A, Glatting KH, Westermann F BMC Genomics. 9:52(2008).