Stem-loop sequence hsa-mir-214

AccessionMI0000290 (change log)
Symbol HGNC:MIR214
DescriptionHomo sapiens miR-214 stem-loop
Gene family MIPF0000062; mir-214
Literature search

289 open access papers mention hsa-mir-214
(2821 sentences)

Stem-loop
   ggccu      acaga           u          aca            aacau 
5'      ggcugg     guugucaugug cugccugucu   cuugcugugcag     c
        ||||||     ||||||||||| ||||||||||   ||||||||||||     c
3'      ccgacc     caacaguacac gacggacaga   ggacgacauguc     g
   ----u      -----           u          cac            cacuc 
Get sequence
Deep sequencing
130534 reads, 460 reads per million, 136 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Landgraf et al. confirm expression in human [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 172138798-172138907 [-]
antisense
OTTHUMT00000378444 ; DNM3-008; intron 13
OTTHUMT00000084529 ; DNM3-001; intron 14
OTTHUMT00000378443 ; DNM3-007; intron 14
OTTHUMT00000084531 ; DNM3-003; intron 15
ENST00000523513 ; DNM3-008; intron 13
ENST00000367731 ; DNM3-001; intron 14
ENST00000520906 ; DNM3-007; intron 14
ENST00000358155 ; DNM3-201; intron 14
ENST00000355305 ; DNM3-003; intron 15
Clustered miRNAs
< 10kb from hsa-mir-214
hsa-mir-199a-2chr1: 172144535-172144644 [-]
hsa-mir-3120chr1: 172138808-172138888 [+]
hsa-mir-214chr1: 172138798-172138907 [-]
Database links

Mature sequence hsa-miR-214-5p

Accession MIMAT0004564
Previous IDshsa-miR-214*
Sequence

30 - 

ugccugucuacacuugcugugc

 - 51

Get sequence
Deep sequencing6571 reads, 119 experiments
Evidence experimental; cloned [2-3], Northern [3]
Database links
Predicted targets

Mature sequence hsa-miR-214-3p

Accession MIMAT0000271
Previous IDshsa-miR-214
Sequence

71 - 

acagcaggcacagacaggcagu

 - 92

Get sequence
Deep sequencing123503 reads, 133 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:18230126 "New miRNAs cloned from neuroblastoma" Afanasyeva EA, Hotz-Wagenblatt A, Glatting KH, Westermann F BMC Genomics. 9:52(2008).