Stem-loop sequence hsa-mir-214

Accession MI0000290
Symbol HGNC:MIR214
Description Homo sapiens miR-214 stem-loop
Gene family MIPF0000062; mir-214
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled MiR-214. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-214 is a vertebrate-specific family of microRNA precursors. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC which effects RNA interference.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   ggccu      acaga           u          aca            aacau 
5'      ggcugg     guugucaugug cugccugucu   cuugcugugcag     c
        ||||||     ||||||||||| ||||||||||   ||||||||||||     c
3'      ccgacc     caacaguacac gacggacaga   ggacgacauguc     g
   ----u      -----           u          cac            cacuc 
Get sequence
Deep sequencing
5029 reads, 2.16e+03 reads per million, 60 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Landgraf et al. confirm expression in human [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr1: 172138798-172138907 [-]
antisense
OTTHUMT00000378444 ; DNM3-008; intron 13
OTTHUMT00000084529 ; DNM3-001; intron 14
OTTHUMT00000378443 ; DNM3-007; intron 14
OTTHUMT00000084531 ; DNM3-003; intron 15
ENST00000523513 ; DNM3-008; intron 13
ENST00000367731 ; DNM3-001; intron 14
ENST00000520906 ; DNM3-007; intron 14
ENST00000358155 ; DNM3-201; intron 14
ENST00000355305 ; DNM3-003; intron 15
Clustered miRNAs
< 10kb from hsa-mir-214
hsa-mir-199a-2 chr1: 172144535-172144644 [-]
hsa-mir-3120 chr1: 172138808-172138888 [+]
hsa-mir-214 chr1: 172138798-172138907 [-]
Database links

Mature sequence hsa-miR-214-5p

Accession MIMAT0004564
Previous IDs hsa-miR-214*
Sequence

30 - 

ugccugucuacacuugcugugc

 - 51

Get sequence
Deep sequencing 81 reads, 22 experiments
Evidence experimental; cloned [2-3], Northern [3]
Predicted targets

Mature sequence hsa-miR-214-3p

Accession MIMAT0000271
Previous IDs hsa-miR-214
Sequence

71 - 

acagcaggcacagacaggcagu

 - 92

Get sequence
Deep sequencing 430 reads, 45 experiments
Evidence experimental; cloned [2]
Validated targets
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:18230126 "New miRNAs cloned from neuroblastoma" Afanasyeva EA, Hotz-Wagenblatt A, Glatting KH, Westermann F BMC Genomics. 9:52(2008).