Stem-loop sequence hsa-mir-181a-1

AccessionMI0000289
Previous IDshsa-mir-213
Symbol HGNC:MIR181A1
DescriptionHomo sapiens miR-181a-1 stem-loop
Gene family MIPF0000007; mir-181
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-181_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology miR-181 microRNA precursor is a small non-coding RNA molecule. MicroRNAs (miRNAs) are transcribed as ~70 nucleotide precursors and subsequently processed by the RNase-III type enzyme Dicer to give a ~22 nucleotide mature product. In this case the mature sequence comes from the 5' arm of the precursor. They target and modulate protein expression by inhibiting translation and / or inducing degradation of target messenger RNAs. This new class of genes has recently been shown to play a central role in malignant transformation. miRNA are downregulated in many tumors and thus appear to function as tumor suppressor genes. The mature products miR-181a, miR-181b, miR-181c or miR-181d are thought to have regulatory roles at posttranscriptional level, through complementarity to target mRNAs. miR-181 which has been predicted or experimentally confirmed in a wide number of vertebrate species as rat, zebrafish, and in the pufferfish (see below) (MIPF0000007).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   -u    -uu   -    -   uc  u a   u      cu       a    g  au 
5'   gagu   uga gguu gcu  ag g aca ucaacg  gucggug guuu ga  u
     ||||   ||| |||| |||  || | ||| ||||||  ||||||| |||| ||  a
3'   cuca   acu ccaa cgg  uc c ugu aguugc  cagcuac caaa cu  a
   ac    ucu   a    u   ua  c a   u      --       -    a  aa 
Get sequence
Deep sequencing
932557 reads, 7.78e+03 reads per million, 71 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chr1: 198859044-198859153 [-]
sense
OTTHUMT00000087434 ; RP11-31E23.1-001; intron 2
ENST00000432296 ; MIR181A1HG-001; intron 2
Clustered miRNAs
< 10kb from hsa-mir-181a-1
hsa-mir-181a-1chr1: 198859044-198859153 [-]
hsa-mir-181b-1chr1: 198858873-198858982 [-]
Database links

Mature sequence hsa-miR-181a-5p

Accession MIMAT0000256
Previous IDshsa-miR-181a
Sequence

24 - 

aacauucaacgcugucggugagu

 - 46

Get sequence
Deep sequencing103974 reads, 64 experiments
Evidence experimental; cloned [2,4-6]
Validated targets
Predicted targets

Mature sequence hsa-miR-181a-3p

Accession MIMAT0000270
Previous IDshsa-miR-213;hsa-miR-181a*
Sequence

64 - 

accaucgaccguugauuguacc

 - 85

Get sequence
Deep sequencing9069 reads, 51 experiments
Evidence experimental; cloned [4]
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
6
PMID:17989717 "Small RNAs analysis in CLL reveals a deregulation of miRNA expression and novel miRNA candidates of putative relevance in CLL pathogenesis" Marton S, Garcia MR, Robello C, Persson H, Trajtenberg F, Pritsch O, Rovira C, Naya H, Dighiero G, Cayota A Leukemia. 22:330-338(2008).