Stem-loop sequence hsa-mir-212

AccessionMI0000288 (change log)
Symbol HGNC:MIR212
DescriptionHomo sapiens miR-212 stem-loop
Gene family MIPF0000065; mir-132
Literature search

129 open access papers mention hsa-mir-212
(867 sentences)

Stem-loop
   cggggcaccccgcccgga   c   c   -ca  u     cu      c      ccc     
5'                   cag gcg cgg   cc uggcu  agacug uuacug   gggc 
                     ||| ||| |||   || |||||  |||||| ||||||   ||| c
3'                   guc cgc gcc   gg acuga  ucugac aaugac   cccg 
   ----------ccgccccg   -   a   acc  c     cc      -      --u     
Get sequence
Deep sequencing
12919 reads, 28.5 reads per million, 151 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. The 3' end was not experimentally determined. The sequence maps to human chromosome 17, but its expression has not been experimentally verified in human.

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 2050271-2050380 [-]
sense
OTTHUMT00000438476 ; SMG6-011; intron 1
OTTHUMT00000438474 ; SMG6-010; intron 2
OTTHUMT00000438059 ; SMG6-005; intron 5
OTTHUMT00000438057 ; SMG6-002; intron 6
OTTHUMT00000437826 ; SMG6-001; intron 13
ENST00000570874 ; SMG6-011; intron 1
ENST00000575454 ; SMG6-010; intron 2
ENST00000536871 ; SMG6-005; intron 5
ENST00000354901 ; SMG6-002; intron 6
ENST00000263073 ; SMG6-001; intron 13
ENST00000544865 ; SMG6-201; intron 13
Clustered miRNAs
< 10kb from hsa-mir-212
hsa-mir-212chr17: 2050271-2050380 [-]
hsa-mir-132chr17: 2049908-2050008 [-]
Database links

Mature sequence hsa-miR-212-5p

Accession MIMAT0022695
Sequence

31 - 

accuuggcucuagacugcuuacu

 - 53

Get sequence
Deep sequencing3118 reads, 134 experiments
Evidence not experimental
Database links
Predicted targets

Mature sequence hsa-miR-212-3p

Accession MIMAT0000269
Previous IDshsa-miR-212
Sequence

71 - 

uaacagucuccagucacggcc

 - 91

Get sequence
Deep sequencing9781 reads, 148 experiments
Evidence by similarity; MI0003385
Database links
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).