Stem-loop sequence hsa-mir-212

Accession MI0000288
Symbol HGNC:MIR212
Description Homo sapiens miR-212 stem-loop
Gene family MIPF0000065; mir-132
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-132. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology miR-132 microRNA is a short non-coding RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms, generally reducing protein levels through the cleavage of mRNAs or the repression of their translation. Several targets for miR-132 have been described, including mediators of neurological development, synaptic transmission, inflammation and angiogenesis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
cggggcaccccgcccgga   c   c   -ca  u     cu      c      ccc     
                  cag gcg cgg   cc uggcu  agacug uuacug   gggc 
                  ||| ||| |||   || |||||  |||||| ||||||   ||| c
                  guc cgc gcc   gg acuga  ucugac aaugac   cccg 
----------ccgccccg   -   a   acc  c     cc      -      --u     
Get sequence
Deep sequencing
362 reads, 27 experiments
Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. The 3' end was not experimentally determined. The sequence maps to human chromosome 17, but its expression has not been experimentally verified in human.

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr17: 1953565-1953674 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-212
hsa-mir-212 chr17: 1953565-1953674 [-]
hsa-mir-132 chr17: 1953202-1953302 [-]
Database links

Mature sequence hsa-miR-212-5p

Accession MIMAT0022695
Sequence

31 - 

accuuggcucuagacugcuuacu

 - 53

Get sequence
Deep sequencing 273 reads, 14 experiments
Evidence not experimental
Predicted targets

Mature sequence hsa-miR-212-3p

Accession MIMAT0000269
Previous IDs hsa-miR-212
Sequence

71 - 

uaacagucuccagucacggcc

 - 91

Get sequence
Deep sequencing 54 reads, 12 experiments
Evidence by similarity; MI0003385
Validated targets
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).