Stem-loop sequence hsa-mir-211

Accession

MI0000287

Symbol

HGNC:MIR211

Description

Homo sapiens miR-211 stem-loop

Gene family

MIPF0000042; mir-204

Stem-loop

-  --ac   -gccau     uug     u         ca     c    agg  u 
 uc    cug      gugac   ugggc ucccuuugu  uccuu gccu   gc c
 ||    |||      |||||   ||||| |||||||||  ||||| ||||   || u
 ag    gac      cacug   acucg ggggaaacg  aggga cggg   cg g
g  gcac   acccuu     uug     u         ac     -    --a  a 

Deep sequencing

38958 reads, 19 experiments

Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. The sequence maps to human chromosome 15.

Genome context

• Coordinates (GRCh37.p5): chr15: 31357235-31357344 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000417380 ; TRPM1-006; intron 4

  OTTHUMT00000417381 ; TRPM1-007; intron 4

  OTTHUMT00000417167 ; TRPM1-002; intron 4

  OTTHUMT00000417380 ; TRPM1-006; intron 4

  OTTHUMT00000417381 ; TRPM1-007; intron 4

  OTTHUMT00000417167 ; TRPM1-002; intron 4

  OTTHUMT00000251378 ; TRPM1-001; intron 6

  OTTHUMT00000251378 ; TRPM1-001; intron 6

  OTTHUMT00000417382 ; TRPM1-008; intron 6

  OTTHUMT00000417385 ; TRPM1-005; intron 6

  OTTHUMT00000251378 ; TRPM1-001; intron 6

  OTTHUMT00000417382 ; TRPM1-008; intron 6

  OTTHUMT00000417385 ; TRPM1-005; intron 6

  OTTHUMT00000417166 ; TRPM1-004; intron 7

  OTTHUMT00000417166 ; TRPM1-004; intron 7

  ENST00000560801 ; TRPM1-006; intron 4

  ENST00000558768 ; TRPM1-007; intron 4

  ENST00000559177 ; TRPM1-002; intron 4

  ENST00000560801 ; TRPM1-006; intron 4

  ENST00000558768 ; TRPM1-007; intron 4

  ENST00000559177 ; TRPM1-002; intron 4

  ENST00000397793 ; TRPM1-202; intron 5

  ENST00000397793 ; TRPM1-201; intron 5

  ENST00000397795 ; TRPM1-001; intron 6

  ENST00000542188 ; TRPM1-203; intron 6

  ENST00000397795 ; TRPM1-001; intron 6

  ENST00000558445 ; TRPM1-008; intron 6

  ENST00000560658 ; TRPM1-005; intron 6

  ENST00000542188 ; TRPM1-202; intron 6

  ENST00000397795 ; TRPM1-001; intron 6

  ENST00000558445 ; TRPM1-008; intron 6

  ENST00000560658 ; TRPM1-005; intron 6

  ENST00000542188 ; TRPM1-201; intron 6

  ENST00000256552 ; TRPM1-201; intron 7

  ENST00000256552 ; TRPM1-004; intron 7

  ENST00000256552 ; TRPM1-004; intron 7

  antisense

  ENST00000437966 ; CHRNA7-202; intron 2

Database links

• EMBL: AJ550414;HSA550414
• ENTREZGENE: 406993;MIR211
• HGNC: 31588;MIR211

Mature sequence hsa-miR-211-5p

• Accession: MIMAT0000268
• Previous IDs: hsa-miR-211
• Sequence: 26 - uucccuuugucauccuucgccu - 47
• Deep sequencing: 38040 reads, 19 experiments
• Evidence: by similarity; MI0001377
• Predicted targets:
  • DIANA-MICROT:hsa-miR-211-5p
  • MICRORNA.ORG:hsa-miR-211-5p
  • MIRDB:hsa-miR-211-5p
  • RNA22-HSA:hsa-miR-211-5p
  • TARGETMINER:hsa-miR-211-5p
  • TARGETSCAN-VERT:hsa-miR-211
  • PICTAR-VERT:hsa-miR-211

Mature sequence hsa-miR-211-3p

• Accession: MIMAT0022694
• Sequence: 63 - gcagggacagcaaaggggugc - 83
• Deep sequencing: 786 reads, 11 experiments
• Evidence: not experimental
• Predicted targets:
  • DIANA-MICROT:hsa-miR-211-3p
  • MIRDB:hsa-miR-211-3p
  • TARGETMINER:hsa-miR-211-3p
  • PICTAR-VERT:hsa-miR-211

References

1. PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).