Stem-loop sequence hsa-mir-211

AccessionMI0000287
Symbol HGNC:MIR211
DescriptionHomo sapiens miR-211 stem-loop
Gene family MIPF0000042; mir-204
Stem-loop
   -  --ac   -gccau     uug     u         ca     c    agg  u 
5'  uc    cug      gugac   ugggc ucccuuugu  uccuu gccu   gc c
    ||    |||      |||||   ||||| |||||||||  ||||| ||||   || u
3'  ag    gac      cacug   acucg ggggaaacg  aggga cggg   cg g
   g  gcac   acccuu     uug     u         ac     -    --a  a 
Get sequence
Deep sequencing
37589 reads, 9.29e+03 reads per million, 32 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. The sequence maps to human chromosome 15.

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr15: 31065032-31065141 [-]
antisense
OTTHUMT00000430733 ; ARHGAP11B-007; exon 5
ENST00000602616 ; ARHGAP11B-007; exon 5
Database links

Mature sequence hsa-miR-211-5p

Accession MIMAT0000268
Previous IDshsa-miR-211
Sequence

26 - 

uucccuuugucauccuucgccu

 - 47

Get sequence
Deep sequencing30528 reads, 18 experiments
Evidence by similarity; MI0001377
Validated targets
Predicted targets

Mature sequence hsa-miR-211-3p

Accession MIMAT0022694
Sequence

63 - 

gcagggacagcaaaggggugc

 - 83

Get sequence
Deep sequencing450 reads, 11 experiments
Evidence not experimental
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).