Stem-loop sequence hsa-mir-210

AccessionMI0000286 (change log)
Symbol HGNC:MIR210
DescriptionHomo sapiens miR-210 stem-loop
Gene family MIPF0000086; mir-210
Literature search

334 open access papers mention hsa-mir-210
(2481 sentences)

Stem-loop
   accc  ca    -c           gg     c   cc   -      c  c -     
5'     gg  gugc  uccaggcgcag  cagcc cug  cac cgcaca ug g cugc 
       ||  ||||  |||||||||||  ||||| |||  ||| |||||| || | ||| c
3'     cc  cgcg  ggguccguguc  gucgg gac  gug gcgugu ac c gacc 
   ---c  ag    ac           ua     c   -a   u      c  c a     
Get sequence
Deep sequencing
67035 reads, 160 reads per million, 159 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Its expression was later verified in human BC-1 cells [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 568089-568198 [-]
sense
OTTHUMT00000383231 ; MIR210HG-001; intron 1
OTTHUMT00000383232 ; MIR210HG-002; intron 1
OTTHUMT00000383233 ; MIR210HG-003; intron 1
OTTHUMT00000383234 ; MIR210HG-004; intron 1
ENST00000500447 ; MIR210HG-001; intron 1
ENST00000528245 ; MIR210HG-002; intron 1
ENST00000533920 ; MIR210HG-003; intron 1
ENST00000534540 ; MIR210HG-004; intron 1
Database links

Mature sequence hsa-miR-210-5p

Accession MIMAT0026475
Sequence

28 - 

agccccugcccaccgcacacug

 - 49

Get sequence
Deep sequencing555 reads, 108 experiments
Evidence experimental; Illumina [5]
Database links
Predicted targets

Mature sequence hsa-miR-210-3p

Accession MIMAT0000267
Sequence

66 - 

cugugcgugugacagcggcuga

 - 87

Get sequence
Deep sequencing66359 reads, 158 experiments
Evidence experimental; cloned [2-4], Illumina [5]
Database links
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15800047 "Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells" Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR Proc Natl Acad Sci U S A. 102:5570-5575(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
5
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).