Stem-loop sequence hsa-mir-210

Accession MI0000286
Symbol HGNC:MIR210
Description Homo sapiens miR-210 stem-loop
Gene family MIPF0000086; mir-210
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-210_microRNA. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-210 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms. mir-210 has been strongly linked with the hypoxia pathway, and is upregulated in response to Hypoxia-inducible factors. It is also overexpressed in cells affected by cardiac disease and tumours. MiRNA-210 in particular, has been studied for its effects in rescuing cardiac function after myocardial infarcts via the up-regulation of angiogenesis and inhibition of cardiomyocyte apoptosis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
accc  ca    -c           gg     c   cc   -      c  c -     
    gg  gugc  uccaggcgcag  cagcc cug  cac cgcaca ug g cugc 
    ||  ||||  |||||||||||  ||||| |||  ||| |||||| || | ||| c
    cc  cgcg  ggguccguguc  gucgg gac  gug gcgugu ac c gacc 
---c  ag    ac           ua     c   -a   u      c  c a     
Get sequence
Deep sequencing
2490 reads, 36 experiments
Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Its expression was later verified in human BC-1 cells [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr11: 568089-568198 [-]
sense
OTTHUMT00000383231 ; RP11-496I9.3-001; intron 1
OTTHUMT00000383232 ; RP11-496I9.3-002; intron 1
OTTHUMT00000383233 ; RP11-496I9.3-003; intron 1
OTTHUMT00000383234 ; RP11-496I9.3-004; intron 1
OTTHUMT00000383231 ; MIR210HG-001; intron 1
OTTHUMT00000383232 ; MIR210HG-002; intron 1
OTTHUMT00000383233 ; MIR210HG-003; intron 1
OTTHUMT00000383234 ; MIR210HG-004; intron 1
OTTHUMT00000383231 ; MIR210HG-001; intron 1
OTTHUMT00000383232 ; MIR210HG-002; intron 1
OTTHUMT00000383233 ; MIR210HG-003; intron 1
OTTHUMT00000383234 ; MIR210HG-004; intron 1
ENST00000500447 ; MIR210HG-001; intron 1
ENST00000528245 ; MIR210HG-002; intron 1
ENST00000533920 ; MIR210HG-003; intron 1
ENST00000534540 ; MIR210HG-004; intron 1
ENST00000500447 ; MIR210HG-001; intron 1
ENST00000528245 ; MIR210HG-002; intron 1
ENST00000533920 ; MIR210HG-003; intron 1
ENST00000534540 ; MIR210HG-004; intron 1
ENST00000500447 ; MIR210HG-001; intron 1
ENST00000528245 ; MIR210HG-002; intron 1
ENST00000533920 ; MIR210HG-003; intron 1
ENST00000534540 ; MIR210HG-004; intron 1
Database links

Mature sequence hsa-miR-210

Accession MIMAT0000267
Sequence

66 - 

cugugcgugugacagcggcuga

 - 87

Get sequence
Deep sequencing 2475 reads, 32 experiments
Evidence experimental; cloned [2-4]
Validated targets
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15800047 "Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells" Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR Proc Natl Acad Sci U S A. 102:5570-5575(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).