Stem-loop sequence hsa-mir-205

AccessionMI0000285 (change log)
Symbol HGNC:MIR205
DescriptionHomo sapiens miR-205 stem-loop
Gene family MIPF0000058; mir-205
Literature search

320 open access papers mention hsa-mir-205
(1803 sentences)

Stem-loop
   aaagaucc    acaa       gcuu      uc           c        ucuca 
5'         ucag    uccaugu    cucuug  cuucauuccac ggagucug     u
           ||||    |||||||    ||||||  ||||||||||| ||||||||     a
3'         aguc    agguacg    gaggac  gaagugaggug cuuuagac     c
   ------ac    ---g       ----      uu           a        caacc 
Get sequence
Deep sequencing
1496079 reads, 6.21e+03 reads per million, 140 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Landgraf et al. confirm expression in human [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 209432133-209432242 [+]
intergenic
Database links

Mature sequence hsa-miR-205-5p

Accession MIMAT0000266
Previous IDshsa-miR-205
Sequence

34 - 

uccuucauuccaccggagucug

 - 55

Get sequence
Deep sequencing1492681 reads, 140 experiments
Evidence experimental; cloned [2-3]
Database links
Predicted targets

Mature sequence hsa-miR-205-3p

Accession MIMAT0009197
Previous IDshsa-miR-205*
Sequence

71 - 

gauuucaguggagugaaguuc

 - 91

Get sequence
Deep sequencing3153 reads, 75 experiments
Evidence experimental; 454 [4]
Database links
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
4
PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).