Stem-loop sequence hsa-mir-205

Accession MI0000285
Symbol HGNC:MIR205
Description Homo sapiens miR-205 stem-loop
Gene family MIPF0000058; mir-205
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-205. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology miR-205 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms. They are involved in numerous cellular processes, including development, proliferation, and apoptosis. Currently, it is believed that miRNAs elicit their effect by silencing the expression of target genes. The miR-200 family (miR-200a, miR-200b, miR-200c, miR-141 and miR-429) and miR-205 are frequently silenced in advanced cancer. Studies has shown that by targeting the transcriptional repressors of E-cadherin, ZEB1 and ZEB2, it is involved in epithelial to mesenchymal transition (EMT) and tumor invasion. Recently, miR-200 silencing was also reported in cancer stem cells, implying that miR-200 deregulation is a key event in multiple levels of tumor biology. However, what prevents miR-200 expression remains largely unanswered.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
aaagaucc    acaa       gcuu      uc           c        ucuca 
        ucag    uccaugu    cucuug  cuucauuccac ggagucug     u
        ||||    |||||||    ||||||  ||||||||||| ||||||||     a
        aguc    agguacg    gaggac  gaagugaggug cuuuagac     c
------ac    ---g       ----      uu           a        caacc 
Get sequence
Deep sequencing
1441 reads, 27 experiments
Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Landgraf et al. confirm expression in human [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr1: 209605478-209605587 [+]
sense
OTTHUMT00000088231 ; CTA-55I10.1-001; intron 1
OTTHUMT00000088231 ; CTA-55I10.1-001; exon 2
OTTHUMT00000088231 ; CTA-55I10.1-001; exon 2
OTTHUMT00000088233 ; CTA-55I10.1-003; intron 3
OTTHUMT00000088519 ; CTA-55I10.1-004; intron 3
OTTHUMT00000088522 ; CTA-55I10.1-007; intron 3
OTTHUMT00000098592 ; CTA-55I10.1-008; intron 3
OTTHUMT00000088522 ; CTA-55I10.1-007; intron 3
OTTHUMT00000088522 ; CTA-55I10.1-007; intron 3
OTTHUMT00000088232 ; CTA-55I10.1-002; intron 4
OTTHUMT00000088233 ; CTA-55I10.1-003; exon 4
OTTHUMT00000088519 ; CTA-55I10.1-004; exon 4
OTTHUMT00000098592 ; CTA-55I10.1-008; exon 4
OTTHUMT00000088233 ; CTA-55I10.1-003; exon 4
OTTHUMT00000088519 ; CTA-55I10.1-004; exon 4
OTTHUMT00000098592 ; CTA-55I10.1-008; exon 4
OTTHUMT00000088232 ; CTA-55I10.1-002; exon 5
OTTHUMT00000088232 ; CTA-55I10.1-002; exon 5
ENST00000433108 ; CTA-55I10.1-001; intron 1
ENST00000433108 ; MIR205HG-001; exon 2
ENST00000433108 ; MIR205HG-001; exon 2
ENST00000451937 ; CTA-55I10.1-003; intron 3
ENST00000431096 ; CTA-55I10.1-004; intron 3
ENST00000458250 ; CTA-55I10.1-007; intron 3
ENST00000440276 ; CTA-55I10.1-008; intron 3
ENST00000366437 ; CTA-55I10.1-201; intron 3
ENST00000458250 ; MIR205HG-007; intron 3
ENST00000458250 ; MIR205HG-007; intron 3
ENST00000429156 ; CTA-55I10.1-002; intron 4
ENST00000451937 ; MIR205HG-003; exon 4
ENST00000431096 ; MIR205HG-004; exon 4
ENST00000440276 ; MIR205HG-008; exon 4
ENST00000366437 ; MIR205HG-201; exon 4
ENST00000451937 ; MIR205HG-003; exon 4
ENST00000431096 ; MIR205HG-004; exon 4
ENST00000440276 ; MIR205HG-008; exon 4
ENST00000366437 ; MIR205HG-201; exon 4
ENST00000429156 ; MIR205HG-002; exon 5
ENST00000429156 ; MIR205HG-002; exon 5
Database links

Mature sequence hsa-miR-205-5p

Accession MIMAT0000266
Previous IDs hsa-miR-205
Sequence

34 - 

uccuucauuccaccggagucug

 - 55

Get sequence
Deep sequencing 1390 reads, 20 experiments
Evidence experimental; cloned [2-3]
Validated targets
Predicted targets

Mature sequence hsa-miR-205-3p

Accession MIMAT0009197
Previous IDs hsa-miR-205*
Sequence

71 - 

gauuucaguggagugaaguuc

 - 91

Get sequence
Deep sequencing 41 reads, 10 experiments
Evidence experimental; 454 [4]
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
4
PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).