Stem-loop sequence hsa-mir-204

AccessionMI0000284
Symbol HGNC:MIR204
DescriptionHomo sapiens miR-204 stem-loop
Gene family MIPF0000042; mir-204
Stem-loop
   ggcuacagucuuucu   -  -    ucg     u          a     u    gagaau 
5'                uca ug ugac   uggac ucccuuuguc uccua gccu      a
                  ||| || ||||   ||||| |||||||||| ||||| ||||      u
3'                ggu ac acug   acuug agggaaacgg agggu cgga      a
   --------------c   c  u    uua     c          a     -    ggaagu 
Get sequence
Deep sequencing
4851 reads, 1.59e+03 reads per million, 53 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Landgraf et al. confirm expression in human [2].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr9: 70809975-70810084 [-]
intergenic
Database links

Mature sequence hsa-miR-204-5p

Accession MIMAT0000265
Previous IDshsa-miR-204
Sequence

33 - 

uucccuuugucauccuaugccu

 - 54

Get sequence
Deep sequencing1445 reads, 40 experiments
Evidence experimental; cloned [2]
Validated targets
Predicted targets

Mature sequence hsa-miR-204-3p

Accession MIMAT0022693
Sequence

72 - 

gcugggaaggcaaagggacgu

 - 92

Get sequence
Deep sequencing259 reads, 35 experiments
Evidence not experimental
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).