Stem-loop sequence hsa-mir-204

AccessionMI0000284 (change log)
Symbol HGNC:MIR204
DescriptionHomo sapiens miR-204 stem-loop
Gene family MIPF0000042; mir-204
Literature search

191 open access papers mention hsa-mir-204
(1563 sentences)

Stem-loop
   ggcuacagucuuucu   -  -    ucg     u          a     u    gagaau 
5'                uca ug ugac   uggac ucccuuuguc uccua gccu      a
                  ||| || ||||   ||||| |||||||||| ||||| ||||      u
3'                ggu ac acug   acuug agggaaacgg agggu cgga      a
   --------------c   c  u    uua     c          a     -    ggaagu 
Get sequence
Deep sequencing
87215 reads, 400 reads per million, 146 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Landgraf et al. confirm expression in human [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 70809975-70810084 [-]
intergenic
Database links

Mature sequence hsa-miR-204-5p

Accession MIMAT0000265
Previous IDshsa-miR-204
Sequence

33 - 

uucccuuugucauccuaugccu

 - 54

Get sequence
Deep sequencing84706 reads, 143 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-204-3p

Accession MIMAT0022693
Sequence

72 - 

gcugggaaggcaaagggacgu

 - 92

Get sequence
Deep sequencing2289 reads, 92 experiments
Evidence not experimental
Database links
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).