Stem-loop sequence hsa-mir-204

Accession MI0000284
Symbol HGNC:MIR204
Description Homo sapiens miR-204 stem-loop
Gene family MIPF0000042; mir-204
Stem-loop 
ggcuacagucuuucu   -  -    ucg     u          a     u    gagaau 
               uca ug ugac   uggac ucccuuuguc uccua gccu      a
               ||| || ||||   ||||| |||||||||| ||||| ||||      u
               ggu ac acug   acuug agggaaacgg agggu cgga      a
--------------c   c  u    uua     c          a     -    ggaagu
Get sequence
Deep sequencing
31666 reads, 26 experiments
Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Landgraf et al. confirm expression in human [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr9: 73424891-73425000 [-]
sense
OTTHUMT00000214162 ; TRPM3-012; intron 3
OTTHUMT00000214162 ; TRPM3-012; intron 3
OTTHUMT00000214162 ; TRPM3-012; intron 3
OTTHUMT00000356082 ; TRPM3-016; intron 4
OTTHUMT00000214159 ; TRPM3-009; intron 4
OTTHUMT00000356082 ; TRPM3-016; intron 4
OTTHUMT00000214159 ; TRPM3-009; intron 4
OTTHUMT00000356082 ; TRPM3-016; intron 4
OTTHUMT00000214159 ; TRPM3-009; intron 4
OTTHUMT00000214161 ; TRPM3-011; intron 5
OTTHUMT00000214164 ; TRPM3-015; intron 5
OTTHUMT00000214161 ; TRPM3-011; intron 5
OTTHUMT00000214164 ; TRPM3-015; intron 5
OTTHUMT00000214161 ; TRPM3-011; intron 5
OTTHUMT00000214164 ; TRPM3-015; intron 5
OTTHUMT00000052614 ; TRPM3-005; intron 6
OTTHUMT00000214157 ; TRPM3-007; intron 6
OTTHUMT00000214158 ; TRPM3-008; intron 6
OTTHUMT00000214160 ; TRPM3-010; intron 6
OTTHUMT00000214163 ; TRPM3-014; intron 6
OTTHUMT00000052614 ; TRPM3-005; intron 6
OTTHUMT00000214157 ; TRPM3-007; intron 6
OTTHUMT00000214158 ; TRPM3-008; intron 6
OTTHUMT00000214160 ; TRPM3-010; intron 6
OTTHUMT00000214163 ; TRPM3-014; intron 6
OTTHUMT00000052614 ; TRPM3-005; intron 6
OTTHUMT00000214157 ; TRPM3-007; intron 6
OTTHUMT00000214158 ; TRPM3-008; intron 6
OTTHUMT00000214160 ; TRPM3-010; intron 6
OTTHUMT00000214163 ; TRPM3-014; intron 6
OTTHUMT00000052611 ; TRPM3-002; intron 7
OTTHUMT00000052611 ; TRPM3-002; intron 7
OTTHUMT00000052611 ; TRPM3-002; intron 7
ENST00000396280 ; TRPM3-012; intron 3
ENST00000396280 ; TRPM3-012; intron 3
ENST00000396280 ; TRPM3-012; intron 3
ENST00000408909 ; TRPM3-016; intron 4
ENST00000396285 ; TRPM3-009; intron 4
ENST00000408909 ; TRPM3-016; intron 4
ENST00000396285 ; TRPM3-009; intron 4
ENST00000408909 ; TRPM3-016; intron 4
ENST00000396285 ; TRPM3-009; intron 4
ENST00000396292 ; TRPM3-011; intron 5
ENST00000358082 ; TRPM3-015; intron 5
ENST00000396292 ; TRPM3-011; intron 5
ENST00000358082 ; TRPM3-015; intron 5
ENST00000396292 ; TRPM3-011; intron 5
ENST00000358082 ; TRPM3-015; intron 5
ENST00000377111 ; TRPM3-007; intron 6
ENST00000377110 ; TRPM3-008; intron 6
ENST00000357533 ; TRPM3-014; intron 6
ENST00000377101 ; TRPM3-010; intron 6
ENST00000361823 ; TRPM3-005; intron 6
ENST00000377105 ; TRPM3-202; intron 6
ENST00000455451 ; TRPM3-205; intron 6
ENST00000377111 ; TRPM3-007; intron 6
ENST00000377110 ; TRPM3-008; intron 6
ENST00000357533 ; TRPM3-014; intron 6
ENST00000377101 ; TRPM3-010; intron 6
ENST00000361823 ; TRPM3-005; intron 6
ENST00000377105 ; TRPM3-202; intron 6
ENST00000455451 ; TRPM3-205; intron 6
ENST00000377111 ; TRPM3-007; intron 6
ENST00000377110 ; TRPM3-008; intron 6
ENST00000357533 ; TRPM3-014; intron 6
ENST00000377101 ; TRPM3-010; intron 6
ENST00000361823 ; TRPM3-005; intron 6
ENST00000377105 ; TRPM3-202; intron 6
ENST00000396283 ; TRPM3-002; intron 7
ENST00000423814 ; TRPM3-204; intron 7
ENST00000377106 ; TRPM3-203; intron 7
ENST00000360823 ; TRPM3-201; intron 7
ENST00000396283 ; TRPM3-002; intron 7
ENST00000423814 ; TRPM3-204; intron 7
ENST00000377106 ; TRPM3-203; intron 7
ENST00000360823 ; TRPM3-201; intron 7
ENST00000396283 ; TRPM3-002; intron 7
ENST00000423814 ; TRPM3-204; intron 7
ENST00000377106 ; TRPM3-203; intron 7
ENST00000360823 ; TRPM3-201; intron 7
Database links

Mature sequence hsa-miR-204-5p

Accession MIMAT0000265
Previous IDs hsa-miR-204
Sequence

33 -  

uucccuuugucauccuaugccu

 - 54

Get sequence
Deep sequencing 31281 reads, 21 experiments
Evidence experimental; cloned [2]
Validated targets
Predicted targets

Mature sequence hsa-miR-204-3p

Accession MIMAT0022693
Sequence

72 -  

gcugggaaggcaaagggacgu

 - 92

Get sequence
Deep sequencing 323 reads, 13 experiments
Evidence not experimental
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).