Stem-loop sequence hsa-mir-203a

Accession MI0000283
Previous IDs hsa-mir-203
Symbol HGNC:MIR203
Description Homo sapiens miR-203a stem-loop
Gene family MIPF0000108; mir-203
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled MiR-203. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology miR-203 is a short non-coding RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms, such as translational repression and Argonaute-catalyzed messenger RNA cleavage. miR-203 has been identified as a skin-specific microRNA, and it forms an expression gradient that defines the boundary between proliferative epidermal basal progenitors and terminally differentiating suprabasal cells. It has also been found upregulated in psoriasis and differentially expressed in some types of cancer.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
g     gg a u   g         c         u    g    a     - ug 
 uguug  g c cgc cgcuggguc agugguucu aaca uuca caguu c  u
 |||||  | | ||| ||||||||| ||||||||| |||| |||| ||||| |   
 gcgac  c g gcg gcggcccag ucaccagga uugu aagu guuaa g  a
a     ag g c   g         a         u    a    -     c cg 
Get sequence
Deep sequencing
630 reads, 31 experiments
Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Landgraf et al. confirm expression in human [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr14: 104583742-104583851 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-203a
hsa-mir-203a chr14: 104583742-104583851 [+]
hsa-mir-203b chr14: 104583755-104583840 [-]
Database links

Mature sequence hsa-miR-203a

Accession MIMAT0000264
Previous IDs hsa-miR-203
Sequence

65 - 

gugaaauguuuaggaccacuag

 - 86

Get sequence
Deep sequencing 614 reads, 24 experiments
Evidence experimental; cloned [2]
Validated targets
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17622355 "MicroRNAs: novel regulators involved in the pathogenesis of psoriasis?" Sonkoly E, Wei T, Janson PC, Saaf A, Lundeberg L, Tengvall-Linder M, Norstedt G, Alenius H, Homey B, Scheynius A, Stahle M, Pivarcsi A PLoS One. 2:e610(2007).