Stem-loop sequence hsa-mir-203a

AccessionMI0000283 (change log)
Previous IDshsa-mir-203
Symbol HGNC:MIR203A
DescriptionHomo sapiens miR-203a stem-loop
Gene family MIPF0000108; mir-203
Literature search

297 open access papers mention hsa-mir-203a
(2703 sentences)

Stem-loop
   g     gg a u   g         c         u    g    a     - ug 
5'  uguug  g c cgc cgcuggguc agugguucu aaca uuca caguu c  u
    |||||  | | ||| ||||||||| ||||||||| |||| |||| ||||| |   
3'  gcgac  c g gcg gcggcccag ucaccagga uugu aagu guuaa g  a
   a     ag g c   g         a         u    a    -     c cg 
Get sequence
Deep sequencing
188200 reads, 524 reads per million, 147 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Landgraf et al. confirm expression in human [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 104117405-104117514 [+]
sense
OTTHUMT00000414859 ; KLC1-021; intron 1
OTTHUMT00000402947 ; KLC1-001; intron 1
OTTHUMT00000402944 ; KLC1-003; intron 1
OTTHUMT00000414860 ; KLC1-022; intron 1
OTTHUMT00000402945 ; KLC1-002; intron 1
OTTHUMT00000414861 ; KLC1-009; intron 1
OTTHUMT00000414862 ; KLC1-008; intron 1
OTTHUMT00000402946 ; KLC1-005; intron 1
OTTHUMT00000414863 ; KLC1-016; intron 1
OTTHUMT00000414864 ; KLC1-010; intron 1
OTTHUMT00000414866 ; KLC1-011; intron 1
OTTHUMT00000414867 ; KLC1-013; intron 1
OTTHUMT00000414868 ; KLC1-020; intron 1
OTTHUMT00000402950 ; KLC1-004; intron 1
OTTHUMT00000414869 ; KLC1-017; intron 1
OTTHUMT00000414871 ; KLC1-015; intron 1
OTTHUMT00000402943 ; RP11-73M18.2-001; intron 4
ENST00000557172 ; KLC1-021; intron 1
ENST00000348520 ; KLC1-001; intron 1
ENST00000380038 ; KLC1-003; intron 1
ENST00000555467 ; KLC1-022; intron 1
ENST00000389744 ; KLC1-002; intron 1
ENST00000557575 ; KLC1-009; intron 1
ENST00000553286 ; KLC1-008; intron 1
ENST00000347839 ; KLC1-005; intron 1
ENST00000555836 ; KLC1-016; intron 1
ENST00000334553 ; KLC1-010; intron 1
ENST00000246489 ; KLC1-011; intron 1
ENST00000554228 ; KLC1-013; intron 1
ENST00000557450 ; KLC1-020; intron 1
ENST00000452929 ; KLC1-004; intron 1
ENST00000554280 ; KLC1-017; intron 1
ENST00000445352 ; KLC1-015; intron 1
ENST00000472726 ; RP11-73M18.2-001; intron 4
Clustered miRNAs
< 10kb from hsa-mir-203a
hsa-mir-203achr14: 104117405-104117514 [+]
hsa-mir-203bchr14: 104117418-104117503 [-]
Database links

Mature sequence hsa-miR-203a-5p

Accession MIMAT0031890
Sequence

27 - 

agugguucuuaacaguucaacaguu

 - 51

Get sequence
Deep sequencing607 reads, 75 experiments
Evidence not experimental
Database links
Predicted targets

Mature sequence hsa-miR-203a-3p

Accession MIMAT0000264
Previous IDshsa-miR-203a
Sequence

65 - 

gugaaauguuuaggaccacuag

 - 86

Get sequence
Deep sequencing187572 reads, 147 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17622355 "MicroRNAs: novel regulators involved in the pathogenesis of psoriasis?" Sonkoly E, Wei T, Janson PC, Saaf A, Lundeberg L, Tengvall-Linder M, Norstedt G, Alenius H, Homey B, Scheynius A, Stahle M, Pivarcsi A PLoS One. 2:e610(2007).