Stem-loop sequence hsa-mir-199b

Accession

MI0000282

Symbol

HGNC:MIR199B

Description

Homo sapiens miR-199b stem-loop

Gene family

MIPF0000040; mir-199

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-199_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

The miR-199 microRNA precursor (homologous to miR-215), is a short non-coding RNA gene involved in gene regulation. miR-192 and miR-215 have now been predicted or experimentally confirmed in mouse, human and a further 21 other species. (MIPF0000040). microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The mature products are thought to have regulatory roles through complementarity to mRNA.

Stem-loop

cca    -acacc    cu  -     c       u       u    u  ----  a 
   gagg      ucca  cc gucua ccagugu uagacua cugu ca    gg c
   ||||      ||||  || ||||| ||||||| ||||||| |||| ||    ||  
   cucc      gggu  gg cggau gguuaca gucugau gaca gu    cc u
-gg    cagauu    cg  u     u       c       -    u  uaaa  c 

Deep sequencing

159716 reads, 50 experiments

Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised 5' miR has been validated in zebrafish, the ends mapped by cloning [2], and later verified in human [3].

Genome context

• Coordinates (GRCh37.p5): chr9: 131007000-131007109 [-]
• Overlapping transcripts:

  antisense

  OTTHUMT00000054371 ; DNM1-005; intron 2

  OTTHUMT00000054372 ; DNM1-006; intron 2

  OTTHUMT00000054371 ; DNM1-005; intron 2

  OTTHUMT00000054372 ; DNM1-006; intron 2

  OTTHUMT00000054371 ; DNM1-005; intron 2

  OTTHUMT00000054372 ; DNM1-006; intron 2

  OTTHUMT00000259166 ; DNM1-004; intron 14

  OTTHUMT00000259166 ; DNM1-004; intron 14

  OTTHUMT00000259166 ; DNM1-004; intron 14

  OTTHUMT00000355651 ; DNM1-007; intron 15

  OTTHUMT00000355653 ; DNM1-009; intron 15

  OTTHUMT00000054367 ; DNM1-001; intron 15

  OTTHUMT00000054368 ; DNM1-002; intron 15

  OTTHUMT00000355654 ; DNM1-010; intron 15

  OTTHUMT00000355651 ; DNM1-007; intron 15

  OTTHUMT00000355653 ; DNM1-009; intron 15

  OTTHUMT00000054367 ; DNM1-001; intron 15

  OTTHUMT00000054368 ; DNM1-002; intron 15

  OTTHUMT00000355654 ; DNM1-010; intron 15

  OTTHUMT00000355651 ; DNM1-007; intron 15

  OTTHUMT00000355653 ; DNM1-009; intron 15

  OTTHUMT00000054367 ; DNM1-001; intron 15

  OTTHUMT00000054368 ; DNM1-002; intron 15

  OTTHUMT00000355654 ; DNM1-010; intron 15

  ENST00000479174 ; DNM1-005; intron 2

  ENST00000493925 ; DNM1-006; intron 2

  ENST00000479174 ; DNM1-005; intron 2

  ENST00000493925 ; DNM1-006; intron 2

  ENST00000479174 ; DNM1-005; intron 2

  ENST00000493925 ; DNM1-006; intron 2

  ENST00000543158 ; DNM1-202; intron 5

  ENST00000543158 ; DNM1-202; intron 5

  ENST00000441149 ; DNM1-004; intron 14

  ENST00000393589 ; DNM1-201; intron 14

  ENST00000441149 ; DNM1-004; intron 14

  ENST00000393589 ; DNM1-201; intron 14

  ENST00000441149 ; DNM1-004; intron 14

  ENST00000475805 ; DNM1-007; intron 15

  ENST00000341179 ; DNM1-009; intron 15

  ENST00000372923 ; DNM1-001; intron 15

  ENST00000393594 ; DNM1-002; intron 15

  ENST00000486160 ; DNM1-010; intron 15

  ENST00000475805 ; DNM1-007; intron 15

  ENST00000341179 ; DNM1-009; intron 15

  ENST00000372923 ; DNM1-001; intron 15

  ENST00000393594 ; DNM1-002; intron 15

  ENST00000486160 ; DNM1-010; intron 15

  ENST00000475805 ; DNM1-007; intron 15

  ENST00000341179 ; DNM1-009; intron 15

  ENST00000372923 ; DNM1-001; intron 15

  ENST00000393594 ; DNM1-002; intron 15

  ENST00000486160 ; DNM1-010; intron 15

Clustered miRNAs

< 10kb from hsa-mir-199b

• hsa-mir-3154: chr9: 131007226-131007309 [-]
• hsa-mir-199b: chr9: 131007000-131007109 [-]

Database links

• EMBL: AJ550412;HSA550412
• ENTREZGENE: 406978;MIR199B
• HGNC: 31573;MIR199B

Mature sequence hsa-miR-199b-5p

• Accession: MIMAT0000263
• Previous IDs: hsa-miR-199b
• Sequence: 26 - cccaguguuuagacuaucuguuc - 48
• Deep sequencing: 186 reads, 17 experiments
• Evidence: experimental; cloned [2-3]
• Validated targets:
  • MIRECORDS:hsa-miR-199b-5p
  • MIRTARBASE:hsa-miR-199b-5p
  • TARBASE:hsa-miR-199b-5p
• Predicted targets:
  • DIANA-MICROT:hsa-miR-199b-5p
  • MICRORNA.ORG:hsa-miR-199b-5p
  • MIRDB:hsa-miR-199b-5p
  • RNA22-HSA:hsa-miR-199b-5p
  • TARGETMINER:hsa-miR-199b-5p
  • TARGETSCAN-VERT:hsa-miR-199b-5p
  • PICTAR-VERT:hsa-miR-199b

Mature sequence hsa-miR-199b-3p

• Accession: MIMAT0004563
• Sequence: 65 - acaguagucugcacauugguua - 86
• Deep sequencing: 159530 reads, 42 experiments
• Evidence: experimental; cloned [3]
• Validated targets:
  • MIRTARBASE:hsa-miR-199b-3p
  • TARBASE:hsa-miR-199b-3p
• Predicted targets:
  • DIANA-MICROT:hsa-miR-199b-3p
  • MICRORNA.ORG:hsa-miR-199b-3p
  • MIRDB:hsa-miR-199b-3p
  • RNA22-HSA:hsa-miR-199b-3p
  • TARGETMINER:hsa-miR-199b-3p
  • TARGETSCAN-VERT:hsa-miR-199b-3p
  • PICTAR-VERT:hsa-miR-199b

References

1. PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2. PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).