Stem-loop sequence hsa-mir-199b

AccessionMI0000282
Symbol HGNC:MIR199B
DescriptionHomo sapiens miR-199b stem-loop
Gene family MIPF0000040; mir-199
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-199_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-199 microRNA precursor is a short non-coding RNA gene involved in gene regulation. miR-199 genes have now been predicted or experimentally confirmed in mouse, human and a further 21 other species. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The mature products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   cca    -acacc    cu  -     c       u       u    u  ----  a 
5'    gagg      ucca  cc gucua ccagugu uagacua cugu ca    gg c
      ||||      ||||  || ||||| ||||||| ||||||| |||| ||    ||  
3'    cucc      gggu  gg cggau gguuaca gucugau gaca gu    cc u
   -gg    cagauu    cg  u     u       c       -    u  uaaa  c 
Get sequence
Deep sequencing
75818 reads, 6.16e+03 reads per million, 73 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised 5' miR has been validated in zebrafish, the ends mapped by cloning [2], and later verified in human [3].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr9: 128244721-128244830 [-]
sense
OTTHUMT00000054087 ; MAPKAP1-004; intron 1
OTTHUMT00000355311 ; MAPKAP1-018; intron 2
OTTHUMT00000355309 ; MAPKAP1-016; intron 5
OTTHUMT00000054088 ; MAPKAP1-005; intron 6
OTTHUMT00000355308 ; MAPKAP1-015; intron 8
OTTHUMT00000054092 ; MAPKAP1-009; intron 8
OTTHUMT00000054090 ; MAPKAP1-007; intron 8
OTTHUMT00000054091 ; MAPKAP1-008; intron 8
ENST00000444226 ; MAPKAP1-004; intron 1
ENST00000496063 ; MAPKAP1-018; intron 2
ENST00000373497 ; MAPKAP1-202; intron 4
ENST00000497932 ; MAPKAP1-016; intron 5
ENST00000420643 ; MAPKAP1-005; intron 6
ENST00000394063 ; MAPKAP1-203; intron 7
ENST00000373511 ; MAPKAP1-015; intron 8
ENST00000373498 ; MAPKAP1-009; intron 8
ENST00000350766 ; MAPKAP1-007; intron 8
ENST00000373503 ; MAPKAP1-008; intron 8
ENST00000265960 ; MAPKAP1-201; intron 9
Clustered miRNAs
< 10kb from hsa-mir-199b
hsa-mir-3154chr9: 128244947-128245030 [-]
hsa-mir-199bchr9: 128244721-128244830 [-]
Database links

Mature sequence hsa-miR-199b-5p

Accession MIMAT0000263
Previous IDshsa-miR-199b
Sequence

26 - 

cccaguguuuagacuaucuguuc

 - 48

Get sequence
Deep sequencing392 reads, 38 experiments
Evidence experimental; cloned [2-3]
Validated targets
Predicted targets

Mature sequence hsa-miR-199b-3p

Accession MIMAT0004563
Sequence

65 - 

acaguagucugcacauugguua

 - 86

Get sequence
Deep sequencing3833 reads, 63 experiments
Evidence experimental; cloned [3]
Validated targets
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).