Stem-loop sequence hsa-mir-199a-2

Accession MI0000281
Symbol HGNC:MIR199A2
Description Homo sapiens miR-199a-2 stem-loop
Gene family MIPF0000040; mir-199
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-199_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-199 microRNA precursor (homologous to miR-215), is a short non-coding RNA gene involved in gene regulation. miR-192 and miR-215 have now been predicted or experimentally confirmed in mouse, human and a further 21 other species. (MIPF0000040). microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The mature products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
aggaa   u  ggaga    -    c   gcc       u        c   --uca  ac 
     gcu cu     uccu gcuc guc   ccagugu cagacuac ugu     gg  a
     ||| ||     |||| |||| |||   ||||||| |||||||| |||     ||   
     cga ga     ggga cggg cag   gguuaca gucugaug aca     cc  a
----a   -  -----    a    u   auu       c        -   uguug  gu 
Get sequence
Deep sequencing
162675 reads, 56 experiments
Comments

Lagos-Quintana et al. [1] cloned miR-199 from human osteoblast sarcoma cells. They also reported identification of a miRNA from the opposite arm in mouse cells. This sequence was named miR-199-s and the sequence from the 3' arm of the homologous mouse precursor miR-199-as. Lim et al. [2] independently predicted this miRNA computationally using conservation with mouse and Fugu rubripes sequences [2]. Expression of the miR excised from the 5' arm was validated in zebrafish, and the ends mapped by cloning. The excised miR sequences are renamed miR-199a (to avoid confusion with the subsequently identified miR-199b (MI0000282 )) and miR-199a* (from the 3' arm) here. The two putative hairpin precursors in human map to chromosome 19 (mir-199a-1, MI0000242 ) and chromosome 1 (mir-199a-2, MI0000281 ). Landgraf et al. show that both mature products are expressed, prompting the renaming to miR-199a-5p and miR-199a-3p [4].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr1: 172113675-172113784 [-]
sense
OTTHUMT00000098131 ; RP5-1116C7.1-001; intron 1
OTTHUMT00000098131 ; RP5-1116C7.1-001; intron 1
OTTHUMT00000098131 ; RP5-1116C7.1-001; intron 1
ENST00000417354 ; DNM3-AS1-001; intron 1
ENST00000417354 ; DNM3OS-001; intron 1
ENST00000417354 ; DNM3OS-001; intron 1
antisense
OTTHUMT00000378444 ; DNM3-008; intron 13
OTTHUMT00000378444 ; DNM3-008; intron 13
OTTHUMT00000378444 ; DNM3-008; intron 13
OTTHUMT00000084529 ; DNM3-001; intron 14
OTTHUMT00000378443 ; DNM3-007; intron 14
OTTHUMT00000084529 ; DNM3-001; intron 14
OTTHUMT00000378443 ; DNM3-007; intron 14
OTTHUMT00000084529 ; DNM3-001; intron 14
OTTHUMT00000378443 ; DNM3-007; intron 14
OTTHUMT00000084531 ; DNM3-003; intron 15
OTTHUMT00000084531 ; DNM3-003; intron 15
OTTHUMT00000084531 ; DNM3-003; intron 15
ENST00000523513 ; DNM3-008; intron 13
ENST00000523513 ; DNM3-008; intron 13
ENST00000523513 ; DNM3-008; intron 13
ENST00000367731 ; DNM3-001; intron 14
ENST00000520906 ; DNM3-007; intron 14
ENST00000358155 ; DNM3-201; intron 14
ENST00000367731 ; DNM3-001; intron 14
ENST00000520906 ; DNM3-007; intron 14
ENST00000358155 ; DNM3-201; intron 14
ENST00000367731 ; DNM3-001; intron 14
ENST00000520906 ; DNM3-007; intron 14
ENST00000358155 ; DNM3-201; intron 14
ENST00000355305 ; DNM3-003; intron 15
ENST00000359070 ; DNM3-202; intron 15
ENST00000355305 ; DNM3-003; intron 15
ENST00000359070 ; DNM3-202; intron 15
ENST00000355305 ; DNM3-003; intron 15
Clustered miRNAs
< 10kb from hsa-mir-199a-2
hsa-mir-199a-2 chr1: 172113675-172113784 [-]
hsa-mir-3120 chr1: 172107948-172108028 [+]
hsa-mir-214 chr1: 172107938-172108047 [-]
Database links

Mature sequence hsa-miR-199a-5p

Accession MIMAT0000231
Previous IDs hsa-miR-199a
Sequence

31 - 

cccaguguucagacuaccuguuc

 - 53

Get sequence
Deep sequencing 4263 reads, 36 experiments
Evidence experimental; cloned [2-4]
Validated targets
Predicted targets

Mature sequence hsa-miR-199a-3p

Accession MIMAT0000232
Previous IDs hsa-miR-199a*
Sequence

70 - 

acaguagucugcacauugguua

 - 91

Get sequence
Deep sequencing 159789 reads, 54 experiments
Evidence experimental; cloned [4], Solexa [5]
Validated targets
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
3
PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5