Stem-loop sequence hsa-mir-196a-2

Accession

MI0000279

Previous IDs

hsa-mir-196-2

Symbol

HGNC:MIR196A2

Description

Homo sapiens miR-196a-2 stem-loop

Gene family

MIPF0000031; mir-196

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-196_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

miR-196 is a non-coding RNA called a microRNA that has been shown to be expressed in human (MI0000238, MI0000279) and mouse (MI0000552, MI0000553). miR-196 appears to be a vertebrate specific microRNA and has now been predicted or experimentally confirmed in a wide range of vertebrate species (MIPF0000031). In many species the miRNA appears to be expressed from intergenic regions in HOX gene clusters. The hairpin precursors are predicted based on base pairing and cross-species conservation—their extents are not known. In this case the mature sequence is excised from the 5' arm of the hairpin. It has been suggested that a rare SNP (rs11614913) that overlaps hsa-mir-196a2 has been found to be associated with non-small cell lung carcinoma.

Stem-loop

-ug    - -uc       --c                  a          a ug   
   cucg c   agcugau   uguggcuuagguaguuuc uguuguuggg u  ag 
   |||| |   |||||||   |||||||||||||||||| |||||||||| |  | u
   gagc g   uuggcug   acauugaguccgucaaag acaacggcuc a  uu 
cgg    u cuu       acu                  a          a gu   

Deep sequencing

8932 reads, 23 experiments

Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. miR-196a was later validated in human [3,4]. Yekta et al. report that miR-196 miRNAs are expressed from HOX gene clusters in mammals, and that HOX genes in these clusters are targets of miR-196. Indeed, HOXB8 mRNA was shown to be a natural target for miR-196-directed cleavage through a perfectly complementary miR-target site. Other HOX genes have imperfect miR-196 complementary sites indicative of regulation by translational repression [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context

• Coordinates (GRCh37.p5): chr12: 54385522-54385631 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000358949 ; HOXC5-003; intron 1

  OTTHUMT00000358945 ; HOXC6-003; intron 1

  OTTHUMT00000358949 ; HOXC5-003; intron 1

  OTTHUMT00000358945 ; HOXC6-003; intron 1

  OTTHUMT00000358949 ; HOXC5-003; intron 1

  OTTHUMT00000358945 ; HOXC6-003; intron 1

  ENST00000513209 ; HOXC5-003; intron 1

  ENST00000504315 ; HOXC6-003; intron 1

  ENST00000513209 ; HOXC5-003; intron 1

  ENST00000504315 ; HOXC6-003; intron 1

  ENST00000513209 ; HOXC5-003; intron 1

  ENST00000504315 ; HOXC6-003; intron 1

Database links

• EMBL: AJ560753;HSA560753
• ENTREZGENE: 406973;MIR196A2
• HGNC: 31568;MIR196A2

Mature sequence hsa-miR-196a-5p

• Accession: MIMAT0000226
• Previous IDs: hsa-miR-196a
• Sequence: 25 - uagguaguuucauguuguuggg - 46
• Deep sequencing: 8897 reads, 31 experiments
• Evidence: experimental; cloned [3-5]
• Validated targets:
  • TARBASE:hsa-miR-196a-5p
• Predicted targets:
  • DIANA-MICROT:hsa-miR-196a-5p
  • MICRORNA.ORG:hsa-miR-196a-5p
  • MIRDB:hsa-miR-196a-5p
  • RNA22-HSA:hsa-miR-196a-5p
  • TARGETMINER:hsa-miR-196a-5p
  • TARGETSCAN-VERT:hsa-miR-196a
  • PICTAR-VERT:hsa-miR-196a

Mature sequence hsa-miR-196a-3p

• Accession: MIMAT0004562
• Previous IDs: hsa-miR-196a*
• Sequence: 62 - cggcaacaagaaacugccugag - 83
• Deep sequencing: 100 reads, 10 experiments
• Evidence: experimental; cloned [4]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-196a-3p
  • MICRORNA.ORG:hsa-miR-196a-3p
  • MIRDB:hsa-miR-196a-3p
  • RNA22-HSA:hsa-miR-196a-3p
  • TARGETMINER:hsa-miR-196a-3p
  • PICTAR-VERT:hsa-miR-196a

References

1. PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2. PMID:15105502 "MicroRNA-directed cleavage of HOXB8 mRNA" Yekta S, Shih IH, Bartel DP Science. 304:594-596(2004).
3. PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).