Stem-loop sequence hsa-mir-187

Accession MI0000274
Symbol HGNC:MIR187
Description Homo sapiens miR-187 stem-loop
Gene family MIPF0000078; mir-187
Stem-loop
g u      caccaugacacag    aga    g    a           c  -  c - ug 
 g cgggcu             ugug   ccuc ggcu caacacaggac cg gg g c  c
 | ||||||             ||||   |||| |||| ||||||||||| || || | |   
 c gccugg             acgc   ggag ccga guuguguucug gc cc c g  u
a -      -------------    -ag    g    c           u  u  c a uc 
Get sequence
Deep sequencing
190 reads, 18 experiments
Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. Landgraf et al. confirm expression in human [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr18: 33484781-33484889 [-]
intergenic
Database links

Mature sequence hsa-miR-187-5p

Accession MIMAT0004561
Previous IDs hsa-miR-187*
Sequence

35 - 

ggcuacaacacaggacccgggc

 - 56

Get sequence
Deep sequencing 27 reads, 5 experiments
Evidence experimental; cloned [2]
Predicted targets

Mature sequence hsa-miR-187-3p

Accession MIMAT0000262
Previous IDs hsa-miR-187
Sequence

71 - 

ucgugucuuguguugcagccgg

 - 92

Get sequence
Deep sequencing 163 reads, 15 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).