Stem-loop sequence hsa-mir-183

Accession MI0000273
Symbol HGNC:MIR183
Description Homo sapiens miR-183 stem-loop
Gene family MIPF0000066; mir-183
Stem-loop 
ccgcaga   u  ---c  -         g      --ac     ga        --   ac 
       gug ga    uc cuguucugu uauggc    uggua  auucacug  uga  a
       ||| ||    || ||||||||| ||||||    |||||  ||||||||  |||   
       cac cu    ag gacgagaca auaccg    gccau  uaagugac  acu  g
-----ag   -  agac  a         a      ggaa     --        ug   cu
Get sequence
Deep sequencing
387 reads, 29 experiments
Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. Expression was later confirmed in human [2,3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr7: 129414745-129414854 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-183
hsa-mir-183 chr7: 129414745-129414854 [-]
hsa-mir-96 chr7: 129414532-129414609 [-]
hsa-mir-182 chr7: 129410223-129410332 [-]
Database links

Mature sequence hsa-miR-183-5p

Accession MIMAT0000261
Previous IDs hsa-miR-183
Sequence

27 -  

uauggcacugguagaauucacu

 - 48

Get sequence
Deep sequencing 345 reads, 28 experiments
Evidence experimental; cloned [2-4]
Validated targets
Predicted targets

Mature sequence hsa-miR-183-3p

Accession MIMAT0004560
Previous IDs hsa-miR-183*
Sequence

66 -  

gugaauuaccgaagggccauaa

 - 87

Get sequence
Deep sequencing 42 reads, 7 experiments
Evidence experimental; cloned [3]
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).