Stem-loop sequence hsa-mir-182

AccessionMI0000272
Previous IDshsa-mir-182-as
Symbol HGNC:MIR182
DescriptionHomo sapiens miR-182 stem-loop
Gene family MIPF0000116; mir-182
Stem-loop
   ga    -  --ug    c      uu       u -g      uca      ugaggu 
5'   gcug cu    ccuc ccccgu  uuggcaa g  uagaac   cacugg      a
     |||| ||    |||| ||||||  ||||||| |  ||||||   ||||||       
3'   cggc ga    ggag ggggua  aaccguu c  aucuug   guggcc      a
   ca    c  cuca    c      uc       - ag      ---      uaggac 
Get sequence
Deep sequencing
13504 reads, 1.58e+03 reads per million, 64 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chr7: 129770383-129770492 [-]
antisense
OTTHUMT00000349347 ; KLHDC10-001; 3'UTR (exon 10)
ENST00000335420 ; KLHDC10-001; 3'UTR (exon 10)
Clustered miRNAs
< 10kb from hsa-mir-182
hsa-mir-183chr7: 129774905-129775014 [-]
hsa-mir-96chr7: 129774692-129774769 [-]
hsa-mir-182chr7: 129770383-129770492 [-]
Database links

Mature sequence hsa-miR-182-5p

Accession MIMAT0000259
Previous IDshsa-miR-182
Sequence

23 - 

uuuggcaaugguagaacucacacu

 - 46

Get sequence
Deep sequencing1795 reads, 59 experiments
Evidence experimental; cloned [2-3]
Validated targets
Predicted targets

Mature sequence hsa-miR-182-3p

Accession MIMAT0000260
Previous IDshsa-miR-182*
Sequence

67 - 

ugguucuagacuugccaacua

 - 87

Get sequence
Deep sequencing7 reads, 4 experiments
Evidence by similarity; MI0001368
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).