Stem-loop sequence hsa-mir-181c

AccessionMI0000271 (change log)
Symbol HGNC:MIR181C
DescriptionHomo sapiens miR-181c stem-loop
Gene family MIPF0000007; mir-181
Literature search

279 open access papers mention hsa-mir-181c
(1229 sentences)

Stem-loop
   c   -aaauuug   a  g  ug   gaa        cu       a     ggca 
5'  gga        cca gg uu  ggg   cauucaac  gucggug guuug    g
    |||        ||| || ||  |||   ||||||||  ||||||| |||||    c
3'  ccu        ggu cc ga  ccc   gugaguug  cagcuac caaac    u
   u   accguuaa   -  g  gu   -ag        -c       -     ggac 
Get sequence
Deep sequencing
112975 reads, 180 reads per million, 157 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Landgraf et al. confirm the expression of miR-181c in human [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 13874699-13874808 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-181c
hsa-mir-181cchr19: 13874699-13874808 [+]
hsa-mir-181dchr19: 13874875-13875011 [+]
Database links

Mature sequence hsa-miR-181c-5p

Accession MIMAT0000258
Previous IDshsa-miR-181c
Sequence

27 - 

aacauucaaccugucggugagu

 - 48

Get sequence
Deep sequencing86561 reads, 157 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-181c-3p

Accession MIMAT0004559
Previous IDshsa-miR-181c*
Sequence

65 - 

aaccaucgaccguugaguggac

 - 86

Get sequence
Deep sequencing26397 reads, 153 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).