Stem-loop sequence hsa-mir-181c

Accession MI0000271
Symbol HGNC:MIR181C
Description Homo sapiens miR-181c stem-loop
Gene family MIPF0000007; mir-181
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-181_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology miR-181 microRNA precursor is a small non-coding RNA molecule. MicroRNAs (miRNAs) are transcribed as ~70 nucleotide precursors and subsequently processed by the RNase-III type enzyme Dicer to give a ~22 nucleotide mature product. In this case the mature sequence comes from the 5' arm of the precursor. They target and modulate protein expression by inhibiting translation and / or inducing degradation of target messenger RNAs. This new class of genes has recently been shown to play a central role in malignant transformation. miRNA are downregulated in many tumors and thus appear to function as tumor suppressor genes. The mature products miR-181a, miR-181b, miR-181c or miR-181d are thought to have regulatory roles at posttranscriptional level, through complementarity to target mRNAs. miR-181 which has been predicted or experimentally confirmed in a wide number of vertebrate species as rat, zebrafish, and in the pufferfish (see below) (MIPF0000007).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
c   -aaauuug   a  g  ug   gaa        cu       a     ggca 
 gga        cca gg uu  ggg   cauucaac  gucggug guuug    g
 |||        ||| || ||  |||   ||||||||  ||||||| |||||    c
 ccu        ggu cc ga  ccc   gugaguug  cagcuac caaac    u
u   accguuaa   -  g  gu   -ag        -c       -     ggac 
Get sequence
Deep sequencing
2363 reads, 38 experiments
Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Landgraf et al. confirm the expression of miR-181c in human [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr19: 13985513-13985622 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-181c
hsa-mir-181c chr19: 13985513-13985622 [+]
hsa-mir-181d chr19: 13985689-13985825 [+]
Database links

Mature sequence hsa-miR-181c-5p

Accession MIMAT0000258
Previous IDs hsa-miR-181c
Sequence

27 - 

aacauucaaccugucggugagu

 - 48

Get sequence
Deep sequencing 1386 reads, 28 experiments
Evidence experimental; cloned [2]
Validated targets
Predicted targets

Mature sequence hsa-miR-181c-3p

Accession MIMAT0004559
Previous IDs hsa-miR-181c*
Sequence

65 - 

aaccaucgaccguugaguggac

 - 86

Get sequence
Deep sequencing 976 reads, 25 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).