Stem-loop sequence hsa-mir-181b-1

Accession MI0000270
Previous IDs hsa-mir-181b
Symbol HGNC:MIR181B1
Description Homo sapiens miR-181b-1 stem-loop
Gene family MIPF0000007; mir-181
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-181_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology miR-181 microRNA precursor is a small non-coding RNA molecule. MicroRNAs (miRNAs) are transcribed as ~70 nucleotide precursors and subsequently processed by the RNase-III type enzyme Dicer to give a ~22 nucleotide mature product. In this case the mature sequence comes from the 5' arm of the precursor. They target and modulate protein expression by inhibiting translation and / or inducing degradation of target messenger RNAs. This new class of genes has recently been shown to play a central role in malignant transformation. miRNA are downregulated in many tumors and thus appear to function as tumor suppressor genes. The mature products miR-181a, miR-181b, miR-181c or miR-181d are thought to have regulatory roles at posttranscriptional level, through complementarity to target mRNAs. miR-181 which has been predicted or experimentally confirmed in a wide number of vertebrate species as rat, zebrafish, and in the pufferfish (see below) (MIPF0000007).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
ccugugcagagauuauuuuuuaaaa       aucaa         cug          gaa  g 
                         ggucaca     cauucauug   ucgguggguu   cu u
                         |||||||     |||||||||   ||||||||||   ||  
                         ccggugu     guaaguaac   agucacucga   gg g
-------------------uucgcc       -caac         --a          aca  u 
Get sequence
Deep sequencing
27162 reads, 27 experiments
Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Its expression was later verified in human BC-1 cells [3]. There are two predicted hairpin precursor sequences in the human genome; mir-181b-1 (MI0000270 ) is found on chromosome 1 [1], and mir-181b-2 (MI0000683 ) on chromosome 9 [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr1: 198828002-198828111 [-]
sense
OTTHUMT00000087434 ; RP11-31E23.1-001; intron 2
OTTHUMT00000087434 ; RP11-31E23.1-001; intron 2
OTTHUMT00000087434 ; RP11-31E23.1-001; intron 2
ENST00000432296 ; RP11-31E23.1-001; intron 2
ENST00000432296 ; RP11-31E23.1-001; intron 2
ENST00000432296 ; RP11-31E23.1-001; intron 2
Clustered miRNAs
< 10kb from hsa-mir-181b-1
hsa-mir-181a-1 chr1: 198828173-198828282 [-]
hsa-mir-181b-1 chr1: 198828002-198828111 [-]
Database links

Mature sequence hsa-miR-181b-5p

Accession MIMAT0000257
Previous IDs hsa-miR-181b
Sequence

36 - 

aacauucauugcugucggugggu

 - 58

Get sequence
Deep sequencing 27004 reads, 33 experiments
Evidence experimental; cloned [3-5]
Validated targets
Predicted targets

Mature sequence hsa-miR-181b-3p

Accession MIMAT0022692
Sequence

76 - 

cucacugaacaaugaaugcaa

 - 96

Get sequence
Deep sequencing 390 reads, 19 experiments
Evidence not experimental
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
3
PMID:15800047 "Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells" Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR Proc Natl Acad Sci U S A. 102:5570-5575(2005).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).