Stem-loop sequence hsa-mir-181b-1

AccessionMI0000270 (change log)
Previous IDshsa-mir-181b
Symbol HGNC:MIR181B1
DescriptionHomo sapiens miR-181b-1 stem-loop
Gene family MIPF0000007; mir-181
Literature search

372 open access papers mention hsa-mir-181b-1
(1585 sentences)

Stem-loop
   ccugugcagagauuauuuuuuaaaa       aucaa         cug          gaa  g 
5'                          ggucaca     cauucauug   ucgguggguu   cu u
                            |||||||     |||||||||   ||||||||||   ||  
3'                          ccggugu     guaaguaac   agucacucga   gg g
   -------------------uucgcc       -caac         --a          aca  u 
Get sequence
Deep sequencing
690904 reads, 894 reads per million, 157 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Its expression was later verified in human BC-1 cells [3]. There are two predicted hairpin precursor sequences in the human genome; mir-181b-1 (MI0000270) is found on chromosome 1 [1], and mir-181b-2 (MI0000683) on chromosome 9 [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 198858873-198858982 [-]
sense
OTTHUMT00000087434 ; RP11-31E23.1-001; intron 2
ENST00000432296 ; MIR181A1HG-001; intron 2
Clustered miRNAs
< 10kb from hsa-mir-181b-1
hsa-mir-181a-1chr1: 198859044-198859153 [-]
hsa-mir-181b-1chr1: 198858873-198858982 [-]
Database links

Mature sequence hsa-miR-181b-5p

Accession MIMAT0000257
Previous IDshsa-miR-181b
Sequence

36 - 

aacauucauugcugucggugggu

 - 58

Get sequence
Deep sequencing1387103 reads, 157 experiments
Evidence experimental; cloned [3-5]
Database links
Predicted targets

Mature sequence hsa-miR-181b-3p

Accession MIMAT0022692
Sequence

76 - 

cucacugaacaaugaaugcaa

 - 96

Get sequence
Deep sequencing1896 reads, 119 experiments
Evidence not experimental
Database links
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
3
PMID:15800047 "Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells" Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR Proc Natl Acad Sci U S A. 102:5570-5575(2005).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).