Stem-loop sequence hsa-mir-181a-2

AccessionMI0000269 (change log)
Previous IDshsa-mir-181a
Symbol HGNC:MIR181A2
DescriptionHomo sapiens miR-181a-2 stem-loop
Gene family MIPF0000007; mir-181
Literature search

487 open access papers mention hsa-mir-181a-2
(2524 sentences)

Stem-loop
   agaagggcuaucaggccagccuuca             a   u      cu       a    ggga 
5'                          gaggacuccaagg aca ucaacg  gucggug guuu    u
                            ||||||||||||| ||| ||||||  ||||||| ||||    u
3'                          uuccugggguucc ugu aguugc  cagucac caaa    u
   ------------------------a             a   c      --       -    aaag 
Get sequence
Deep sequencing
2959343 reads, 3.59e+03 reads per million, 160 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Landgraf et al. and Lui et al. later verify expression in human [4-5].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 124692442-124692551 [+]
antisense
OTTHUMT00000053903 ; C9orf148-001; intron 1
OTTHUMT00000106443 ; TTLL11-003; intron 5
OTTHUMT00000053906 ; TTLL11-001; intron 6
ENST00000411790 ; TTLL11-IT1-001; intron 1
ENST00000474723 ; TTLL11-003; intron 5
ENST00000373778 ; TTLL11-001; intron 6
ENST00000321582 ; TTLL11-201; intron 6
Clustered miRNAs
< 10kb from hsa-mir-181a-2
hsa-mir-181a-2chr9: 124692442-124692551 [+]
hsa-mir-181b-2chr9: 124693710-124693798 [+]
Database links

Mature sequence hsa-miR-181a-5p

Accession MIMAT0000256
Previous IDshsa-miR-181a
Sequence

39 - 

aacauucaacgcugucggugagu

 - 61

Get sequence
Deep sequencing5859734 reads, 159 experiments
Evidence experimental; cloned [2,4-6]
Database links
Predicted targets

Mature sequence hsa-miR-181a-2-3p

Accession MIMAT0004558
Previous IDshsa-miR-181a-2*
Sequence

77 - 

accacugaccguugacuguacc

 - 98

Get sequence
Deep sequencing29357 reads, 148 experiments
Evidence experimental; cloned [4]
Database links
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
6
PMID:17989717 "Small RNAs analysis in CLL reveals a deregulation of miRNA expression and novel miRNA candidates of putative relevance in CLL pathogenesis" Marton S, Garcia MR, Robello C, Persson H, Trajtenberg F, Pritsch O, Rovira C, Naya H, Dighiero G, Cayota A Leukemia. 22:330-338(2008).