Stem-loop sequence hsa-mir-34a

Accession MI0000268
Previous IDs hsa-mir-34
Symbol HGNC:MIR34A
Description Homo sapiens miR-34a stem-loop
Gene family MIPF0000039; mir-34
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-34_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The mir-34 microRNA precursor family are non-coding RNA molecules that, in mammals, give rise to three major mature miRNAs. The miR-34 family members were discovered computationally and later verified experimentally. The precursor miRNA stem-loop is processed in the cytoplasm of the cell, with the predominant miR-34 mature sequence excised from the 5' arm of the hairpin. The mature miR-34a is a part of the p53 tumor suppressor network of proteins; therefore, it is hypothesized that miR-34 dysregulation is involved in the development of some cancers.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
-    -a  --    -  ug     uu        -   a          -guga  a 
 ggcc  gc  ugug ag  uuucu  ggcagugu cuu gcugguuguu     gc a
 ||||  ||  |||| ||  |||||  |||||||| ||| ||||||||||     ||  
 ccgg  ug  gcac uc  gaaga  ccgucaua gaa cgacuaacga     ug u
c    gg  uu    g  gu     uc        u   -          aggaa  a 
Get sequence
Deep sequencing
4266 reads, 33 experiments
Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Dostie et al. independently cloned this sequence in human but misnamed the sequence miR-172 (the sequence is unrelated to MIR172 from Arabidopsis) [2]. The sequence maps to human chromosome 1. Human miR-34a was previously named miR-34 here and in [1], but is renamed to clarify homology with the alternatively named mouse sequence (MI0000584 ). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr1: 9211727-9211836 [-]
intergenic
Database links

Mature sequence hsa-miR-34a-5p

Accession MIMAT0000255
Previous IDs hsa-miR-34a
Sequence

22 - 

uggcagugucuuagcugguugu

 - 43

Get sequence
Deep sequencing 4071 reads, 25 experiments
Evidence experimental; cloned [2-4]
Validated targets
Predicted targets

Mature sequence hsa-miR-34a-3p

Accession MIMAT0004557
Previous IDs hsa-miR-34a*
Sequence

64 - 

caaucagcaaguauacugcccu

 - 85

Get sequence
Deep sequencing 192 reads, 18 experiments
Evidence experimental; cloned [3]
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).