Stem-loop sequence hsa-mir-10b

AccessionMI0000267 (change log)
Symbol HGNC:MIR10B
DescriptionHomo sapiens miR-10b stem-loop
Gene family MIPF0000033; mir-10
Literature search

346 open access papers mention hsa-mir-10b
(1985 sentences)

Stem-loop
   cca      guaa     u        a    g     c          -ug   u 
5'    gagguu    cguug cuauauau cccu uagaa cgaauuugug   gua c
      ||||||    ||||| |||||||| |||| ||||| ||||||||||   |||  
3'    cuucaa    guagc gguauaua gggg aucuu gcuuagacac   uau c
   --a      aaac     u        a    -     a          uga   g 
Get sequence
Deep sequencing
4761805 reads, 7.79e+03 reads per million, 159 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Michael et al. subsequently verified expression of miR-10b in human [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 176150303-176150412 [+]
sense
OTTHUMT00000334502 ; AC096649.3-001; intron 1
OTTHUMT00000334503 ; AC096649.3-002; intron 1
ENST00000444567 ; AC096649.3-001; intron 1
ENST00000438963 ; AC096649.3-002; intron 1
Database links

Mature sequence hsa-miR-10b-5p

Accession MIMAT0000254
Previous IDshsa-miR-10b
Sequence

27 - 

uacccuguagaaccgaauuugug

 - 49

Get sequence
Deep sequencing4742890 reads, 159 experiments
Evidence experimental; cloned [2-4]
Database links
Predicted targets

Mature sequence hsa-miR-10b-3p

Accession MIMAT0004556
Previous IDshsa-miR-10b*
Sequence

66 - 

acagauucgauucuaggggaau

 - 87

Get sequence
Deep sequencing18828 reads, 140 experiments
Evidence experimental; cloned [3]
Database links
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).