Stem-loop sequence hsa-mir-10a

AccessionMI0000266 (change log)
Symbol HGNC:MIR10A
DescriptionHomo sapiens miR-10a stem-loop
Gene family MIPF0000033; mir-10
Literature search

272 open access papers mention hsa-mir-10a
(1808 sentences)

Stem-loop
   -----gauc   --c    uu        a    g     c          uaaggaa 
5'          ugu   uguc  cuguauau cccu uagau cgaauuugug       u
            |||   ||||  |||||||| |||| ||||| ||||||||||        
3'          aca   acag  gauguaua gggg aucua gcuuaaacac       u
   ucucgccuc   aau    uu        a    -     u          ugguguu 
Get sequence
Deep sequencing
3270228 reads, 5.18e+03 reads per million, 159 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Mature products were later verified in human [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 48579838-48579947 [-]
intergenic
Database links

Mature sequence hsa-miR-10a-5p

Accession MIMAT0000253
Previous IDshsa-miR-10a
Sequence

22 - 

uacccuguagauccgaauuugug

 - 44

Get sequence
Deep sequencing3254404 reads, 159 experiments
Evidence experimental; cloned [2-3]
Database links
Predicted targets

Mature sequence hsa-miR-10a-3p

Accession MIMAT0004555
Previous IDshsa-miR-10a*
Sequence

63 - 

caaauucguaucuaggggaaua

 - 84

Get sequence
Deep sequencing15562 reads, 137 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).