Stem-loop sequence hsa-mir-7-3

AccessionMI0000265 (change log)
Symbol HGNC:MIR7-3
DescriptionHomo sapiens miR-7-3 stem-loop
Gene family MIPF0000022; mir-7
Literature search

335 open access papers mention hsa-mir-7-3
(2038 sentences)

Stem-loop
   agauua   u  cugu     a        u  aa a  a       u      c  au 
5'       gag gg    ggucu gugcugug gg  g cu gugauuu guuguu ug  g
         ||| ||    ||||| |||||||| ||  | || ||||||| |||||| ||   
3'       cuu cc    ucaga cgcgauac cc  c ga cacugaa caacag au  u
   ---cag   c  ----     -        u  gg c  -       -      c  ca 
Get sequence
Deep sequencing
1112233 reads, 3.28e+03 reads per million, 162 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. Expression in human was later verified by cloning [1,2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 4770670-4770779 [+]
sense
OTTHUMT00000318990 ; MIR7-3HG-001; intron 2
OTTHUMT00000459346 ; MIR7-3HG-004; intron 2
OTTHUMT00000459348 ; MIR7-3HG-003; intron 2
OTTHUMT00000459350 ; MIR7-3HG-010; intron 2
OTTHUMT00000459353 ; MIR7-3HG-006; intron 2
OTTHUMT00000459347 ; MIR7-3HG-009; intron 3
OTTHUMT00000459352 ; MIR7-3HG-008; intron 3
OTTHUMT00000459345 ; MIR7-3HG-002; intron 4
OTTHUMT00000459351 ; MIR7-3HG-005; intron 5
ENST00000384898 ; MIR7-3-201; exon 1
ENST00000317292 ; MIR7-3HG-001; intron 2
ENST00000592709 ; MIR7-3HG-004; intron 2
ENST00000589639 ; MIR7-3HG-003; intron 2
ENST00000592663 ; MIR7-3HG-010; intron 2
ENST00000589368 ; MIR7-3HG-006; intron 2
ENST00000588711 ; MIR7-3HG-009; intron 3
ENST00000588923 ; MIR7-3HG-008; intron 3
ENST00000586721 ; MIR7-3HG-002; intron 4
ENST00000588758 ; MIR7-3HG-005; intron 5
Database links

Mature sequence hsa-miR-7-5p

Accession MIMAT0000252
Previous IDshsa-miR-7
Sequence

31 - 

uggaagacuagugauuuuguuguu

 - 54

Get sequence
Deep sequencing3423555 reads, 162 experiments
Evidence experimental; cloned [2-3]
Database links
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).