Stem-loop sequence hsa-mir-7-2

AccessionMI0000264 (change log)
Symbol HGNC:MIR7-2
DescriptionHomo sapiens miR-7-2 stem-loop
Gene family MIPF0000022; mir-7
Literature search

341 open access papers mention hsa-mir-7-2
(2053 sentences)

Stem-loop
   cuggauacaga    acc       c    cu  a     a u     u       ucuua 
5'            gugg   ggcuggc ccau  gg agacu g gauuu guuguug     c
              ||||   ||||||| ||||  || ||||| | ||||| |||||||      
3'            cgcu   ccgaccg ggua  cc ucuga c cuaaa caacaac     u
   ----------a    --a       u    au  a     c -     -       ucgcg 
Get sequence
Deep sequencing
1118730 reads, 3.27e+03 reads per million, 164 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. Landgraf et al. confirm expression in human [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr15: 88611825-88611934 [+]
antisense
OTTHUMT00000416155 ; NTRK3-017; intron 1
OTTHUMT00000415275 ; NTRK3-004; intron 10
OTTHUMT00000416153 ; NTRK3-015; intron 10
OTTHUMT00000415277 ; NTRK3-003; intron 11
OTTHUMT00000403049 ; NTRK3-002; intron 11
OTTHUMT00000309066 ; NTRK3-001; intron 13
ENST00000558306 ; NTRK3-017; intron 1
ENST00000557856 ; NTRK3-004; intron 10
ENST00000558676 ; NTRK3-015; intron 10
ENST00000542733 ; NTRK3-003; intron 11
ENST00000540489 ; NTRK3-002; intron 11
ENST00000357724 ; NTRK3-203; intron 11
ENST00000360948 ; NTRK3-204; intron 12
ENST00000355254 ; NTRK3-202; intron 12
ENST00000317501 ; NTRK3-201; intron 12
ENST00000394480 ; NTRK3-001; intron 13
Clustered miRNAs
< 10kb from hsa-mir-7-2
hsa-mir-1179chr15: 88608107-88608197 [+]
hsa-mir-7-2chr15: 88611825-88611934 [+]
hsa-mir-3529chr15: 88611847-88611924 [-]
Database links

Mature sequence hsa-miR-7-5p

Accession MIMAT0000252
Previous IDshsa-miR-7
Sequence

32 - 

uggaagacuagugauuuuguuguu

 - 55

Get sequence
Deep sequencing3423555 reads, 162 experiments
Evidence experimental; cloned [2-3]
Database links
Predicted targets

Mature sequence hsa-miR-7-2-3p

Accession MIMAT0004554
Previous IDshsa-miR-7-2*
Sequence

72 - 

caacaaaucccagucuaccuaa

 - 93

Get sequence
Deep sequencing242 reads, 84 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).