Stem-loop sequence hsa-mir-7-1

AccessionMI0000263 (change log)
Symbol HGNC:MIR7-1
DescriptionHomo sapiens miR-7-1 stem-loop
Gene family MIPF0000022; mir-7
Literature search

342 open access papers mention hsa-mir-7-1
(2052 sentences)

Stem-loop
   --u    u  -      a  u        a     a       u      --     a 
5'    ugga gu uggccu gu cugugugg agacu gugauuu guuguu  uuuag u
      |||| || |||||| || |||||||| ||||| ||||||| ||||||  |||||  
3'    aucu cg accgga ca gguauacc ucuga cacuaaa caacag  aaauc a
   gac    c  u      -  c        g     -       -      cu     a 
Get sequence
Deep sequencing
1208991 reads, 3.66e+03 reads per million, 162 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. Landgraf et al. confirm expression in human [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 83969748-83969857 [-]
intergenic
Database links

Mature sequence hsa-miR-7-5p

Accession MIMAT0000252
Previous IDshsa-miR-7
Sequence

24 - 

uggaagacuagugauuuuguuguu

 - 47

Get sequence
Deep sequencing3423555 reads, 162 experiments
Evidence experimental; cloned [2-3]
Database links
Predicted targets

Mature sequence hsa-miR-7-1-3p

Accession MIMAT0004553
Previous IDshsa-miR-7-1*
Sequence

66 - 

caacaaaucacagucugccaua

 - 87

Get sequence
Deep sequencing15569 reads, 155 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).