Stem-loop sequence hsa-mir-147a

AccessionMI0000262
Previous IDshsa-mir-147
Symbol HGNC:MIR147
DescriptionHomo sapiens miR-147a stem-loop
Gene family MIPF0000105; mir-147
Stem-loop
         -a   caa      ug     ---aca   g 
5' aaucua  aga   cauuuc  cacac      cca a
   ||||||  |||   ||||||  |||||      ||| c
3' uuagau  ucu   guaaag  gugug      ggu u
         cg   -uc      gu     accgaa   a 
Get sequence
Deep sequencing
440 reads, 719 reads per million, 33 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Comments

Lagos-Quintana et al. cloned miR-147 from mouse spleen tissue [1], but the sequence is not present in the mouse genome assembly (NCBI32). The human genome sequence contains a predicted precursor hairpin for miR-147 shown in [1] (supplementary information) and represented here. The expression of miR-147 has not been verified in human.

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr9: 120244979-120245050 [-]
intergenic
Database links

Mature sequence hsa-miR-147a

Accession MIMAT0000251
Previous IDshsa-miR-147
Sequence

47 - 

guguguggaaaugcuucugc

 - 66

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence not experimental
Validated targets
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).