Stem-loop sequence hsa-mir-147a

Accession MI0000262
Previous IDs hsa-mir-147
Symbol HGNC:MIR147
Description Homo sapiens miR-147a stem-loop
Gene family MIPF0000105; mir-147
Stem-loop 
      -a   caa      ug     ---aca   g 
aaucua  aga   cauuuc  cacac      cca a
||||||  |||   ||||||  |||||      ||| c
uuagau  ucu   guaaag  gugug      ggu u
      cg   -uc      gu     accgaa   a
Get sequence
Comments

Lagos-Quintana et al. cloned miR-147 from mouse spleen tissue [1], but the sequence is not present in the mouse genome assembly (NCBI32). The human genome sequence contains a predicted precursor hairpin for miR-147 shown in [1] (supplementary information) and represented here. The expression of miR-147 has not been verified in human.

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr9: 123007257-123007328 [-]
intergenic
Database links

Mature sequence hsa-miR-147a

Accession MIMAT0000251
Previous IDs hsa-miR-147
Sequence

47 -  

guguguggaaaugcuucugc

 - 66

Get sequence
Evidence not experimental
Validated targets
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).