Stem-loop sequence hsa-mir-139

Accession

MI0000261

Symbol

HGNC:MIR139

Description

Homo sapiens miR-139 stem-loop

Gene family

MIPF0000117; mir-139

Stem-loop

gug       -   u  a            g gg 
   uauucua cag gc cgugucuccagu u  c
   ||||||| ||| || |||||||||||| |  u
   augaggu guc cg gcgcagaggucg a  c
-ca       u   c  -            g gg 

Deep sequencing

110 reads, 21 experiments

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context

• Coordinates (GRCh37.p5): chr11: 72326107-72326174 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000219841 ; PDE2A-003; intron 1

  OTTHUMT00000397109 ; PDE2A-018; intron 1

  OTTHUMT00000397116 ; PDE2A-021; intron 1

  OTTHUMT00000397117 ; PDE2A-019; intron 1

  OTTHUMT00000397122 ; PDE2A-013; intron 1

  OTTHUMT00000219841 ; PDE2A-003; intron 1

  OTTHUMT00000397109 ; PDE2A-018; intron 1

  OTTHUMT00000397116 ; PDE2A-021; intron 1

  OTTHUMT00000397117 ; PDE2A-019; intron 1

  OTTHUMT00000397122 ; PDE2A-013; intron 1

  OTTHUMT00000219841 ; PDE2A-003; intron 1

  OTTHUMT00000397109 ; PDE2A-018; intron 1

  OTTHUMT00000397116 ; PDE2A-021; intron 1

  OTTHUMT00000397117 ; PDE2A-019; intron 1

  OTTHUMT00000397122 ; PDE2A-013; intron 1

  OTTHUMT00000219839 ; PDE2A-001; intron 2

  OTTHUMT00000219840 ; PDE2A-002; intron 2

  OTTHUMT00000397110 ; PDE2A-010; intron 2

  OTTHUMT00000397118 ; PDE2A-023; intron 2

  OTTHUMT00000397119 ; PDE2A-022; intron 2

  OTTHUMT00000397121 ; PDE2A-020; intron 2

  OTTHUMT00000397123 ; PDE2A-015; intron 2

  OTTHUMT00000219839 ; PDE2A-001; intron 2

  OTTHUMT00000219840 ; PDE2A-002; intron 2

  OTTHUMT00000397110 ; PDE2A-010; intron 2

  OTTHUMT00000397118 ; PDE2A-023; intron 2

  OTTHUMT00000397119 ; PDE2A-022; intron 2

  OTTHUMT00000397121 ; PDE2A-020; intron 2

  OTTHUMT00000397123 ; PDE2A-015; intron 2

  OTTHUMT00000219839 ; PDE2A-001; intron 2

  OTTHUMT00000219840 ; PDE2A-002; intron 2

  OTTHUMT00000397110 ; PDE2A-010; intron 2

  OTTHUMT00000397118 ; PDE2A-023; intron 2

  OTTHUMT00000397119 ; PDE2A-022; intron 2

  OTTHUMT00000397121 ; PDE2A-020; intron 2

  OTTHUMT00000397123 ; PDE2A-015; intron 2

  OTTHUMT00000397111 ; PDE2A-012; intron 3

  OTTHUMT00000219845 ; PDE2A-007; intron 3

  OTTHUMT00000397120 ; PDE2A-017; intron 3

  OTTHUMT00000397124 ; PDE2A-009; intron 3

  OTTHUMT00000397111 ; PDE2A-012; intron 3

  OTTHUMT00000219845 ; PDE2A-007; intron 3

  OTTHUMT00000397120 ; PDE2A-017; intron 3

  OTTHUMT00000397124 ; PDE2A-009; intron 3

  OTTHUMT00000397111 ; PDE2A-012; intron 3

  OTTHUMT00000219845 ; PDE2A-007; intron 3

  OTTHUMT00000397120 ; PDE2A-017; intron 3

  OTTHUMT00000397124 ; PDE2A-009; intron 3

  ENST00000376450 ; PDE2A-003; intron 1

  ENST00000544570 ; PDE2A-018; intron 1

  ENST00000536308 ; PDE2A-021; intron 1

  ENST00000543750 ; PDE2A-019; intron 1

  ENST00000540380 ; PDE2A-013; intron 1

  ENST00000376450 ; PDE2A-003; intron 1

  ENST00000544570 ; PDE2A-018; intron 1

  ENST00000536308 ; PDE2A-021; intron 1

  ENST00000543750 ; PDE2A-019; intron 1

  ENST00000540380 ; PDE2A-013; intron 1

  ENST00000376450 ; PDE2A-003; intron 1

  ENST00000544570 ; PDE2A-018; intron 1

  ENST00000536308 ; PDE2A-021; intron 1

  ENST00000543750 ; PDE2A-019; intron 1

  ENST00000540380 ; PDE2A-013; intron 1

  ENST00000334456 ; PDE2A-001; intron 2

  ENST00000539367 ; PDE2A-002; intron 2

  ENST00000418754 ; PDE2A-010; intron 2

  ENST00000543575 ; PDE2A-023; intron 2

  ENST00000541998 ; PDE2A-022; intron 2

  ENST00000537631 ; PDE2A-020; intron 2

  ENST00000535701 ; PDE2A-015; intron 2

  ENST00000444035 ; PDE2A-202; intron 2

  ENST00000334456 ; PDE2A-001; intron 2

  ENST00000539367 ; PDE2A-002; intron 2

  ENST00000418754 ; PDE2A-010; intron 2

  ENST00000543575 ; PDE2A-023; intron 2

  ENST00000541998 ; PDE2A-022; intron 2

  ENST00000537631 ; PDE2A-020; intron 2

  ENST00000535701 ; PDE2A-015; intron 2

  ENST00000444035 ; PDE2A-202; intron 2

  ENST00000334456 ; PDE2A-001; intron 2

  ENST00000539367 ; PDE2A-002; intron 2

  ENST00000418754 ; PDE2A-010; intron 2

  ENST00000543575 ; PDE2A-023; intron 2

  ENST00000541998 ; PDE2A-022; intron 2

  ENST00000537631 ; PDE2A-020; intron 2

  ENST00000535701 ; PDE2A-015; intron 2

  ENST00000444035 ; PDE2A-201; intron 2

  ENST00000540345 ; PDE2A-012; intron 3

  ENST00000485058 ; PDE2A-007; intron 3

  ENST00000538749 ; PDE2A-017; intron 3

  ENST00000542969 ; PDE2A-009; intron 3

  ENST00000540345 ; PDE2A-012; intron 3

  ENST00000485058 ; PDE2A-007; intron 3

  ENST00000538749 ; PDE2A-017; intron 3

  ENST00000542969 ; PDE2A-009; intron 3

  ENST00000540345 ; PDE2A-012; intron 3

  ENST00000485058 ; PDE2A-007; intron 3

  ENST00000538749 ; PDE2A-017; intron 3

  ENST00000542969 ; PDE2A-009; intron 3

  ENST00000429363 ; PDE2A-201; intron 4

  ENST00000429363 ; PDE2A-201; intron 4

Database links

• ENTREZGENE: 406931;MIR139
• HGNC: 31526;MIR139

Mature sequence hsa-miR-139-5p

• Accession: MIMAT0000250
• Previous IDs: hsa-miR-139
• Sequence: 7 - ucuacagugcacgugucuccagu - 29
• Deep sequencing: 58 reads, 18 experiments
• Evidence: experimental; cloned [2]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-139-5p
  • MICRORNA.ORG:hsa-miR-139-5p
  • MIRDB:hsa-miR-139-5p
  • RNA22-HSA:hsa-miR-139-5p
  • TARGETMINER:hsa-miR-139-5p
  • TARGETSCAN-VERT:hsa-miR-139-5p
  • PICTAR-VERT:hsa-miR-139

Mature sequence hsa-miR-139-3p

• Accession: MIMAT0004552
• Sequence: 43 - uggagacgcggcccuguuggagu - 65
• Deep sequencing: 52 reads, 7 experiments
• Evidence: experimental; cloned [2]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-139-3p
  • MICRORNA.ORG:hsa-miR-139-3p
  • MIRDB:hsa-miR-139-3p
  • RNA22-HSA:hsa-miR-139-3p
  • TARGETMINER:hsa-miR-139-3p
  • TARGETSCAN-VERT:hsa-miR-139-3p
  • PICTAR-VERT:hsa-miR-139

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).