Stem-loop sequence hsa-mir-139

AccessionMI0000261
Symbol HGNC:MIR139
DescriptionHomo sapiens miR-139 stem-loop
Gene family MIPF0000117; mir-139
Stem-loop
   gug       -   u  a            g gg 
5'    uauucua cag gc cgugucuccagu u  c
      ||||||| ||| || |||||||||||| |  u
3'    augaggu guc cg gcgcagaggucg a  c
   -ca       u   c  -            g gg 
Get sequence
Deep sequencing
10572 reads, 495 reads per million, 48 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr11: 72615063-72615130 [-]
sense
OTTHUMT00000329378 ; FCHSD2-001; intron 8
OTTHUMT00000397326 ; FCHSD2-008; intron 8
OTTHUMT00000329430 ; FCHSD2-003; intron 9
OTTHUMT00000329429 ; FCHSD2-002; intron 9
OTTHUMT00000329431 ; FCHSD2-004; intron 9
ENST00000311172 ; FCHSD2-001; intron 8
ENST00000458644 ; FCHSD2-008; intron 8
ENST00000409314 ; FCHSD2-003; intron 9
ENST00000409418 ; FCHSD2-002; intron 9
ENST00000409853 ; FCHSD2-004; intron 9
Database links

Mature sequence hsa-miR-139-5p

Accession MIMAT0000250
Previous IDshsa-miR-139
Sequence

7 - 

ucuacagugcacgugucuccagu

 - 29

Get sequence
Deep sequencing201 reads, 28 experiments
Evidence experimental; cloned [2]
Validated targets
Predicted targets

Mature sequence hsa-miR-139-3p

Accession MIMAT0004552
Sequence

43 - 

uggagacgcggcccuguuggagu

 - 65

Get sequence
Deep sequencing98 reads, 21 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).