Stem-loop sequence mmu-mir-30e

AccessionMI0000259 (change log)
Symbol MGI:Mir30e
DescriptionMus musculus miR-30e stem-loop
Gene family MIPF0000005; mir-30
Literature search

194 open access papers mention mmu-mir-30e
(1192 sentences)

Stem-loop
   g        uu  ua            uu           g aaggu 
5'  ggcagucu  gc  cuguaaacaucc  gacuggaagcu u     g
    ||||||||  ||  ||||||||||||  ||||||||||| |      
3'  ccgucgga  cg  gacauuuguagg  cugacuuucga g     u
   a        --  gc            --           g agagu 
Get sequence
Deep sequencing
8592081 reads, 9.71e+03 reads per million, 107 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr4: 120772606-120772697 [-]
sense
OTTMUST00000020133 ; Nfyc-006; intron 3
OTTMUST00000020132 ; Nfyc-005; intron 4
OTTMUST00000020128 ; Nfyc-001; intron 5
OTTMUST00000020129 ; Nfyc-002; intron 5
OTTMUST00000020130 ; Nfyc-003; intron 5
ENSMUST00000134979 ; Nfyc-006; intron 3
ENSMUST00000136236 ; Nfyc-005; intron 4
ENSMUST00000097906 ; Nfyc-201; intron 4
ENSMUST00000043429 ; Nfyc-001; intron 5
ENSMUST00000118902 ; Nfyc-002; intron 5
ENSMUST00000120779 ; Nfyc-003; intron 5
Clustered miRNAs
< 10kb from mmu-mir-30e
mmu-mir-30fchr4: 120772606-120772697 [+]
mmu-mir-30echr4: 120772606-120772697 [-]
mmu-mir-30c-1chr4: 120769534-120769622 [-]
Database links

Mature sequence mmu-miR-30e-5p

Accession MIMAT0000248
Previous IDsmmu-miR-30e
Sequence

17 - 

uguaaacauccuugacuggaag

 - 38

Get sequence
Deep sequencing7740700 reads, 107 experiments
Evidence experimental; cloned [2,4-5], Illumina [6-7]
Database links
Predicted targets

Mature sequence mmu-miR-30e-3p

Accession MIMAT0000249
Previous IDsmmu-miR-30e*
Sequence

59 - 

cuuucagucggauguuuacagc

 - 80

Get sequence
Deep sequencing850735 reads, 106 experiments
Evidence experimental; cloned [3,5], Illumina [6-7]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
4
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
7
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).