Stem-loop sequence mmu-mir-30e

AccessionMI0000259
Symbol MGI:Mir30e
DescriptionMus musculus miR-30e stem-loop
Gene family MIPF0000005; mir-30
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-30_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-30 microRNA precursor is a small non-coding RNA that regulates gene expression. Animal microRNAs are transcribed as pri-miRNA (primary miRNA) of varying length which in turns are processed in the nucleus by Drosha into ~70 nucleotide stem-loop precursor called pre-miRNA (preliminary miRNA) and subsequently processed by the Dicer enzyme to give a mature ~22 nucleotide product. In this case the mature sequence comes from both the 3' (miR-30) and 5' (mir-97-6) arms of the precursor. The products are thought to have regulatory roles through complementarity to mRNA. A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs. Members of the miR-30 family have been found to be highly expressed in heart cells.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   g        uu  ua            uu           g aaggu 
5'  ggcagucu  gc  cuguaaacaucc  gacuggaagcu u     g
    ||||||||  ||  ||||||||||||  ||||||||||| |      
3'  ccgucgga  cg  gacauuuguagg  cugacuuucga g     u
   a        --  gc            --           g agagu 
Get sequence
Deep sequencing
1815978 reads, 9.09e+03 reads per million, 108 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr4: 120772606-120772697 [-]
sense
OTTMUST00000020133 ; Nfyc-006; intron 3
OTTMUST00000020132 ; Nfyc-005; intron 4
OTTMUST00000020128 ; Nfyc-001; intron 5
OTTMUST00000020129 ; Nfyc-002; intron 5
OTTMUST00000020130 ; Nfyc-003; intron 5
ENSMUST00000134979 ; Nfyc-006; intron 3
ENSMUST00000136236 ; Nfyc-005; intron 4
ENSMUST00000097906 ; Nfyc-201; intron 4
ENSMUST00000043429 ; Nfyc-001; intron 5
ENSMUST00000118902 ; Nfyc-002; intron 5
ENSMUST00000120779 ; Nfyc-003; intron 5
Clustered miRNAs
< 10kb from mmu-mir-30e
mmu-mir-30fchr4: 120772606-120772697 [+]
mmu-mir-30echr4: 120772606-120772697 [-]
mmu-mir-30c-1chr4: 120769534-120769622 [-]
Database links

Mature sequence mmu-miR-30e-5p

Accession MIMAT0000248
Previous IDsmmu-miR-30e
Sequence

17 - 

uguaaacauccuugacuggaag

 - 38

Get sequence
Deep sequencing307283 reads, 93 experiments
Evidence experimental; cloned [2,4-5], Illumina [6-7]
Validated targets
Predicted targets

Mature sequence mmu-miR-30e-3p

Accession MIMAT0000249
Previous IDsmmu-miR-30e*
Sequence

59 - 

cuuucagucggauguuuacagc

 - 80

Get sequence
Deep sequencing262035 reads, 90 experiments
Evidence experimental; cloned [3,5], Illumina [6-7]
Validated targets
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
4
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
7
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).