Stem-loop sequence mmu-mir-143

Accession MI0000257
Symbol MGI:Mir143
Description Mus musculus miR-143 stem-loop
Gene family MIPF0000094; mir-143
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-143. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-143 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by a several mechanisms. mir–143 is highly conserved in vertebrates. mir-143 is thought be involved in cardiac morphogenesis but has also been implicated in cancer.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
      g         g      u  -  ag 
ccugag ugcagugcu caucuc gg uc  u
|||||| ||||||||| |||||| || ||   
ggacuc augucacga guagag cu ag  u
      g         a      u  g  gg 
Get sequence
Deep sequencing
583738 reads, 88 experiments
Comments

Expression of this miRNA in mouse was independently verified in heart and brain [1], embryonic stem cells [2] and testes [3]. The predominant miRNA cloned by Langraf et al. has a 3' terminal U residue, which is incompatible with the genome sequence [4].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr18: 61649196-61649258 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-143
mmu-mir-143 chr18: 61649196-61649258 [-]
mmu-mir-145a chr18: 61647825-61647894 [-]
Database links

Mature sequence mmu-miR-143-5p

Accession MIMAT0017006
Previous IDs mmu-miR-143*
Sequence

6 - 

ggugcagugcugcaucucugg

 - 26

Get sequence
Deep sequencing 14956 reads, 58 experiments
Evidence experimental; 454 [6], Solexa [7]
Predicted targets

Mature sequence mmu-miR-143-3p

Accession MIMAT0000247
Previous IDs mmu-miR-143
Sequence

40 - 

ugagaugaagcacuguagcuc

 - 60

Get sequence
Deep sequencing 566964 reads, 74 experiments
Evidence experimental; cloned [1-4], Solexa [5,7]
Validated targets
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
7
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).