Stem-loop sequence mmu-mir-143

AccessionMI0000257 (change log)
Symbol MGI:Mir143
DescriptionMus musculus miR-143 stem-loop
Gene family MIPF0000094; mir-143
Literature search

177 open access papers mention mmu-mir-143
(1099 sentences)

Stem-loop
         g         g      u  -  ag 
5' ccugag ugcagugcu caucuc gg uc  u
   |||||| ||||||||| |||||| || ||   
3' ggacuc augucacga guagag cu ag  u
         g         a      u  g  gg 
Get sequence
Deep sequencing
15877832 reads, 2.68e+04 reads per million, 103 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Expression of this miRNA in mouse was independently verified in heart and brain [1], embryonic stem cells [2] and testes [3]. The predominant miRNA cloned by Langraf et al. has a 3' terminal U residue, which is incompatible with the genome sequence [4].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr18: 61649196-61649258 [-]
sense
ENSMUST00000083511 ; Mir143-201; exon 1
Clustered miRNAs
< 10kb from mmu-mir-143
mmu-mir-143chr18: 61649196-61649258 [-]
mmu-mir-145achr18: 61647825-61647894 [-]
Database links

Mature sequence mmu-miR-143-5p

Accession MIMAT0017006
Previous IDsmmu-miR-143*
Sequence

6 - 

ggugcagugcugcaucucugg

 - 26

Get sequence
Deep sequencing28728 reads, 80 experiments
Evidence experimental; 454 [6], Illumina [7]
Database links
Predicted targets

Mature sequence mmu-miR-143-3p

Accession MIMAT0000247
Previous IDsmmu-miR-143
Sequence

40 - 

ugagaugaagcacuguagcuc

 - 60

Get sequence
Deep sequencing15849072 reads, 103 experiments
Evidence experimental; cloned [1-4], Illumina [5,7]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
7
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).