Stem-loop sequence mmu-mir-122

AccessionMI0000256 (change log)
Previous IDsmmu-mir-122a
Symbol MGI:Mir122
DescriptionMus musculus miR-122 stem-loop
Gene family MIPF0000095; mir-122
Literature search

264 open access papers mention mmu-mir-122
(2413 sentences)

Stem-loop
         gg       c           -  uc 
5' agcugu  aguguga aaugguguuug ug  c
   ||||||  ||||||| ||||||||||| ||  a
3' ucgaua  ucacacu uuaccgcaaac ac  a
         aa       a           u  ca 
Get sequence
Deep sequencing
3730515 reads, 5.11e+03 reads per million, 93 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr18: 65248861-65248926 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-122
mmu-mir-122chr18: 65248861-65248926 [+]
mmu-mir-122bchr18: 65248863-65248921 [-]
Database links

Mature sequence mmu-miR-122-5p

Accession MIMAT0000246
Previous IDsmmu-miR-122a;mmu-miR-122
Sequence

6 - 

uggagugugacaaugguguuug

 - 27

Get sequence
Deep sequencing3729985 reads, 93 experiments
Evidence experimental; cloned [1-2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-122-3p

Accession MIMAT0017005
Previous IDsmmu-miR-122*
Sequence

41 - 

aaacgccauuaucacacuaaau

 - 62

Get sequence
Deep sequencing529 reads, 20 experiments
Evidence experimental; Illumina [4]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).