Stem-loop sequence mmu-mir-122

AccessionMI0000256
Previous IDsmmu-mir-122a
Symbol MGI:Mirn122a
DescriptionMus musculus miR-122 stem-loop
Gene family MIPF0000095; mir-122
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled MiR-122. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-122 is a miRNA that is conserved between vertebrate species. miR-122 is not present in invertebrates, and no close paralogs of miR-122 have been detected. miR-122 expression is specific to the liver, where it has been implicated as a regulator of fatty-acid metabolism in mouse studies. Reduced miR-122 levels are associated with hepatocellular carcinoma. miR-122 also plays an important positive role in the regulation of hepatitis C virus replication.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
         gg       c           -  uc 
5' agcugu  aguguga aaugguguuug ug  c
   ||||||  ||||||| ||||||||||| ||  a
3' ucgaua  ucacacu uuaccgcaaac ac  a
         aa       a           u  ca 
Get sequence
Deep sequencing
4208201 reads, 9.7e+03 reads per million, 104 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr18: 65248861-65248926 [+]
intergenic
Database links

Mature sequence mmu-miR-122-5p

Accession MIMAT0000246
Previous IDsmmu-miR-122a;mmu-miR-122
Sequence

6 - 

uggagugugacaaugguguuug

 - 27

Get sequence
Deep sequencing3645478 reads, 83 experiments
Evidence experimental; cloned [1-2], Illumina [3-4]
Validated targets
Predicted targets

Mature sequence mmu-miR-122-3p

Accession MIMAT0017005
Previous IDsmmu-miR-122*
Sequence

41 - 

aaacgccauuaucacacuaa

 - 60

Get sequence
Deep sequencing913 reads, 24 experiments
Evidence experimental; Illumina [4]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).