Stem-loop sequence hsa-mir-30d

AccessionMI0000255 (change log)
Symbol HGNC:MIR30D
DescriptionHomo sapiens miR-30d stem-loop
Gene family MIPF0000005; mir-30
Literature search

380 open access papers mention hsa-mir-30d
(1534 sentences)

Stem-loop
   guu  u         ccc           gua  ac 
5'    gu guaaacauc   gacuggaagcu   ag  a
      || |||||||||   |||||||||||   ||   
3'    cg cguuuguag   cugacuuucga   uc  c
   cau  u         --a           --a  ga 
Get sequence
Deep sequencing
8215364 reads, 1.17e+04 reads per million, 159 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 134804876-134804945 [-]
antisense
OTTHUMT00000379148 ; CTD-2588J1.1-001; intron 1
ENST00000517695 ; CTD-2588J1.1-001; intron 1
Clustered miRNAs
< 10kb from hsa-mir-30d
hsa-mir-30dchr8: 134804876-134804945 [-]
hsa-mir-30bchr8: 134800520-134800607 [-]
Database links

Mature sequence hsa-miR-30d-5p

Accession MIMAT0000245
Previous IDshsa-miR-30d
Sequence

6 - 

uguaaacauccccgacuggaag

 - 27

Get sequence
Deep sequencing7750434 reads, 159 experiments
Evidence experimental; cloned [2-4]
Database links
Predicted targets

Mature sequence hsa-miR-30d-3p

Accession MIMAT0004551
Previous IDshsa-miR-30d*
Sequence

46 - 

cuuucagucagauguuugcugc

 - 67

Get sequence
Deep sequencing464895 reads, 157 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
4
PMID:17989717 "Small RNAs analysis in CLL reveals a deregulation of miRNA expression and novel miRNA candidates of putative relevance in CLL pathogenesis" Marton S, Garcia MR, Robello C, Persson H, Trajtenberg F, Pritsch O, Rovira C, Naya H, Dighiero G, Cayota A Leukemia. 22:330-338(2008).