Stem-loop sequence hsa-mir-30d

Accession MI0000255
Symbol HGNC:MIR30D
Description Homo sapiens miR-30d stem-loop
Gene family MIPF0000005; mir-30
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-30_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-30 microRNA precursor is a small non-coding RNA that regulates gene expression. Animal microRNAs are transcribed as pri-miRNA (primary miRNA) of varying length which in turns are processed in the nucleus by Drosha into ~70 nucleotide stem-loop precursor called pre-miRNA (preliminary miRNA) and subsequently processed by the Dicer enzyme to give a mature ~22 nucleotide product. In this case the mature sequence comes from both the 3' (miR-30) and 5' (mir-97-6) arms of the precursor. The products are thought to have regulatory roles through complementarity to mRNA. A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs. Members of the miR-30 family have been found to be highly expressed in heart cells.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
guu  u         ccc           gua  ac 
   gu guaaacauc   gacuggaagcu   ag  a
   || |||||||||   |||||||||||   ||   
   cg cguuuguag   cugacuuucga   uc  c
cau  u         --a           --a  ga 
Get sequence
Deep sequencing
165637 reads, 43 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr8: 135817119-135817188 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-30d
hsa-mir-30d chr8: 135817119-135817188 [-]
hsa-mir-30b chr8: 135812763-135812850 [-]
Database links

Mature sequence hsa-miR-30d-5p

Accession MIMAT0000245
Previous IDs hsa-miR-30d
Sequence

6 - 

uguaaacauccccgacuggaag

 - 27

Get sequence
Deep sequencing 152351 reads, 42 experiments
Evidence experimental; cloned [2-4]
Validated targets
Predicted targets

Mature sequence hsa-miR-30d-3p

Accession MIMAT0004551
Previous IDs hsa-miR-30d*
Sequence

46 - 

cuuucagucagauguuugcugc

 - 67

Get sequence
Deep sequencing 13286 reads, 30 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
4
PMID:17989717 "Small RNAs analysis in CLL reveals a deregulation of miRNA expression and novel miRNA candidates of putative relevance in CLL pathogenesis" Marton S, Garcia MR, Robello C, Persson H, Trajtenberg F, Pritsch O, Rovira C, Naya H, Dighiero G, Cayota A Leukemia. 22:330-338(2008).