miRNA Entry for MI0000254

This text is a summary paragraph taken from the Wikipedia entry entitled mir-30_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The text in this section is taken from the free, online encyclopedia, Wikipedia. Anyone can edit a Wikipedia page. We hope that experts on particular microRNA sequences will use the links to Wikipedia below to edit the annotation of individual microRNAs, to add information about function, evolution, discovery, and literature references, for example. Any changes that you make will be visible in Wikipedia immediately, and in miRBase within 24 hours.

Editing Wikipedia entries is straightforward. If you haven't edited a page before, you might like to take a look at the following Wikipedia help pages:

You can also create new pages at Wikipedia about microRNA families that do not currently have specific entries there. Please let us know if you do, so we can incorporate your annotation into miRBase, and create the appropriate links from miRBase entries to the relevant Wikipedia pages.

Please note, we're not responsible for the content of Wikipedia pages.

You can read more about miRBase, Wikipedia and community annotation on this blog post.

Please email us for help or with comments about this community annotation initiative.

miR-30 microRNA precursor is a small non-coding RNA that regulates gene expression. Animal microRNAs are transcribed as pri-miRNA (primary miRNA) of varying length which in turns are processed in the nucleus by Drosha into ~70 nucleotide stem-loop precursor called pre-miRNA (preliminary miRNA) and subsequently processed by the Dicer enzyme to give a mature ~22 nucleotide product. In this case the mature sequence comes from both the 3' (miR-30) and 5' (mir-97-6) arms of the precursor. The products are thought to have regulatory roles through complementarity to mRNA. A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs. Members of the miR-30 family have been found to be highly expressed in heart cells.

mir-30 microRNA precursor

Predicted secondary structure and sequence conservation of mir-30
Identifiers
Symbol	mir-30
Rfam	RF00131
miRBase	MI0000088
miRBase family	MIPF0000005
Other data
RNA type	Gene; miRNA
Domain(s)	Eukaryota
GO	0035068 0035195
SO	0001244

miR-30 microRNA precursor is a small non-coding RNA that regulates gene expression. Animal microRNAs are transcribed as pri-miRNA (primary miRNA) of varying length which in turns are processed in the nucleus by Drosha into ~70 nucleotide stem-loop precursor called pre-miRNA (preliminary miRNA) and subsequently processed by the Dicer enzyme to give a mature ~22 nucleotide product. In this case the mature sequence comes from both the 3' (miR-30)^[1] and 5' (mir-97-6)^[2] arms of the precursor. The products are thought to have regulatory roles through complementarity to mRNA.^[3]

A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs.^[4]

Members of the miR-30 family have been found to be highly expressed in heart cells.^[5]

1 Targets of miR-30
2 References
3 Further reading
4 External links

[edit] Targets of miR-30

It has been shown that the integrin ITGB3 and the ubiquitin conjugating E2 enzyme UBC9 are downregulated by miR-30.^[6] It has also been suggested that the TP53 protein may be a target of miR-30c and miR-30e. An immunoblot analysis revealed that p53 expression levels were elevated upon knockdown of miR-30c and miR-30e.^[7]

[edit] References

^ Lagos-Quintana, M; Rauhut R, Lendeckel W, Tuschl T (2001). "Identification of novel genes coding for small expressed RNAs". Science 294 (5543): 853–858. doi:10.1126/science.1064921. PMID 11679670.
^ Mourelatos, Z; Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G (2002). "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs". Genes Dev 16 (6): 720–728. doi:10.1101/gad.974702. PMC 155365. PMID 11914277. //www.ncbi.nlm.nih.gov/pmc/articles/PMC155365/.
^ Ambros V (2001). "microRNAs: tiny regulators with great potential". Cell 107 (7): 823–6. doi:10.1016/S0092-8674(01)00616-X. PMID 11779458.
^ Shen J, Ambrosone CB, Zhao H (2009). "Novel genetic variants in microRNA genes and familial breast cancer". Int J Cancer 124 (5): 1178–82. doi:10.1002/ijc.24008. PMID 19048628.
^ Duisters RF, Tijsen AJ, Schroen B, et al. (January 2009). "miR-133 and miR-30 regulate connective tissue growth factor: implications for a role of microRNAs in myocardial matrix remodeling". Circ. Res. 104 (2): 170–8, 6p following 178. doi:10.1161/CIRCRESAHA.108.182535. PMID 19096030.
^ Yu F, Deng H, Yao H, Liu Q, Su F, Song E (July 2010). "Mir-30 reduction maintains self-renewal and inhibits apoptosis in breast tumor-initiating cells". Oncogene 29 (29): 4194–204. doi:10.1038/onc.2010.167. PMID 20498642.
^ Li J, Donath S, Li Y, Qin D, Prabhakar BS, Li P (January 2010). McManus, Michael T.. ed. "miR-30 regulates mitochondrial fission through targeting p53 and the dynamin-related protein-1 pathway". PLoS Genet. 6 (1): e1000795. doi:10.1371/journal.pgen.1000795. PMC 2793031. PMID 20062521. //www.ncbi.nlm.nih.gov/pmc/articles/PMC2793031/.

[edit] Further reading

Agrawal R, Tran U, Wessely O (December 2009). "The miR-30 miRNA family regulates Xenopus pronephros development and targets the transcription factor Xlim1/Lhx1". Development 136 (23): 3927–36. doi:10.1242/dev.037432. PMC 2778741. PMID 19906860. //www.ncbi.nlm.nih.gov/pmc/articles/PMC2778741/.

[edit] External links

Page for mir-30 microRNA precursor at Rfam

v t e miRNA precursor families

1-100	1 2 6 7 8/141/200 9/79 10 15 16 17 19 21 22 24 26 29 30 31 33 34 46/47/281 92 96

101-200	101 103/107 122 124 126 127 129 130 132 133 134 135 137 138 143 144 145 146 148/152 150 155 156 160 166 172 181 184 191 192/215 194 196 199 200

201+	203 205 208 210 214 218 219 221 223 224 296 338 395 399 433 451

Other	BART1 BART2 BHRF1-1 BHRF1-2 BHRF1-3 Let-7 Lin-4 Lsy-6

This molecular or cell biology article is a stub. You can help Wikipedia by expanding it.

Mature sequence hsa-miR-30c-5p
Accession	MIMAT0000244
Previous IDs	hsa-miR-30c
Sequence	7 - uguaaacauccuacacucucagc - 29 Get sequence
Deep sequencing	10471 reads, 44 experiments
Evidence	experimental; cloned [2,4-6]
Validated targets	TARBASE:hsa-miR-30c-5p
Predicted targets	DIANA-MICROT:hsa-miR-30c-5p MICRORNA.ORG:hsa-miR-30c-5p MIRDB:hsa-miR-30c-5p RNA22-HSA:hsa-miR-30c-5p TARGETMINER:hsa-miR-30c-5p TARGETSCAN-VERT:hsa-miR-30c PICTAR-VERT:hsa-miR-30c

Mature sequence hsa-miR-30c-2-3p
Accession	MIMAT0004550
Previous IDs	hsa-miR-30c-2*
Sequence	47 - cugggagaaggcuguuuacucu - 68 Get sequence
Deep sequencing	1875 reads, 25 experiments
Evidence	experimental; cloned [5]
Predicted targets	DIANA-MICROT:hsa-miR-30c-2-3p MICRORNA.ORG:hsa-miR-30c-2-3p MIRDB:hsa-miR-30c-2-3p RNA22-HSA:hsa-miR-30c-2-3p TARGETMINER:hsa-miR-30c-2-3p PICTAR-VERT:hsa-miR-30c

References
1	PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2	PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
3	PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
4	PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
5	PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6	PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).

miRBase

Stem-loop sequence hsa-mir-30c-2

Contents

[edit] Targets of miR-30

[edit] References

[edit] Further reading

[edit] External links

Mature sequence hsa-miR-30c-5p

Mature sequence hsa-miR-30c-2-3p

References