Stem-loop sequence hsa-mir-30c-2

Accession MI0000254
Previous IDs hsa-mir-30c
Symbol HGNC:MIR30C2
Description Homo sapiens miR-30c-2 stem-loop
Gene family MIPF0000005; mir-30
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-30_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-30 microRNA precursor is a small non-coding RNA that regulates gene expression. Animal microRNAs are transcribed as pri-miRNA (primary miRNA) of varying length which in turns are processed in the nucleus by Drosha into ~70 nucleotide stem-loop precursor called pre-miRNA (preliminary miRNA) and subsequently processed by the Dicer enzyme to give a mature ~22 nucleotide product. In this case the mature sequence comes from both the 3' (miR-30) and 5' (mir-97-6) arms of the precursor. The products are thought to have regulatory roles through complementarity to mRNA. A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs. Members of the miR-30 family have been found to be highly expressed in heart cells.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   uacu       u   aca         guggaa 
aga    guaaaca ccu   cucucagcu      a
|||    ||||||| |||   |||||||||       
ucu    cauuugu gga   gagggucga      g
   uucu       c   --a         aagaau 
Get sequence
Deep sequencing
6220 reads, 34 experiments
Comments

miR-30c was cloned from mouse heart and brain tissues by Lagos-Quintana et al. [1]. Two human hairpin precursor sequences are predicted based on homology with the mouse sequences, on chromosomes 1 (MI0000736 ) and 6 (MI0000254 ) [3]. Expression of miR-30c was later independently verified in human HL-60 leukemia cells [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr6: 72086663-72086734 [-]
sense
OTTHUMT00000041155 ; C6orf155-001; intron 3
OTTHUMT00000041167 ; C6orf155-003; intron 3
OTTHUMT00000041155 ; C6orf155-001; intron 3
OTTHUMT00000041167 ; C6orf155-003; intron 3
OTTHUMT00000041155 ; C6orf155-001; intron 3
OTTHUMT00000041167 ; C6orf155-003; intron 3
ENST00000413945 ; C6orf155-001; intron 3
ENST00000436803 ; C6orf155-003; intron 3
ENST00000413945 ; LINC00472-001; intron 3
ENST00000436803 ; LINC00472-003; intron 3
ENST00000413945 ; LINC00472-001; intron 3
ENST00000436803 ; LINC00472-003; intron 3
Database links

Mature sequence hsa-miR-30c-5p

Accession MIMAT0000244
Previous IDs hsa-miR-30c
Sequence

7 - 

uguaaacauccuacacucucagc

 - 29

Get sequence
Deep sequencing 10471 reads, 44 experiments
Evidence experimental; cloned [2,4-6]
Validated targets
Predicted targets

Mature sequence hsa-miR-30c-2-3p

Accession MIMAT0004550
Previous IDs hsa-miR-30c-2*
Sequence

47 - 

cugggagaaggcuguuuacucu

 - 68

Get sequence
Deep sequencing 1875 reads, 25 experiments
Evidence experimental; cloned [5]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
3
4
PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).